EMAIL THIS PAGE TO A FRIEND

MFAP2

microfibrillar-associated protein 2

58 Gene Product Result for
Synonyms: MAGP MAGP-1 MAGP1
UniProtKB ID: P55001, Q53X60, Q5JXY0
Gene ID:
Human(4237) Summary: Microfibrillar-associated protein 2 is a major antigen of elastin-associated microfibrils and a candidate for involvement in the etiology of inherited connective tissue diseases. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Mouse(17150) microfibrillar-associated protein 2
Rat(313662) microfibrillar-associated protein 2
Zebrafish(556677) microfibrillar-associated protein 2
chicken(100858555) microfibrillar-associated protein 2
dog(487416) microfibrillar-associated protein 2
cow(281912) microfibrillar-associated protein 2
domestic cat(101084806) microfibrillar-associated protein 2
sheep(101110395) microfibrillar-associated protein 2
domestic guinea pig(100729367) microfibrillar-associated protein 2
naked mole-rat(101718911) microfibrillar-associated protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002403 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002403 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002403 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008546 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008546 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008546 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002403 Rosetta Predictions human pricing
NM_017459 Rosetta Predictions human pricing
NM_001107989 Rosetta Predictions rat pricing
NM_008546 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185398 predicted 447
2 SASI_Hs01_00185399 predicted 536
3 SASI_Hs01_00185400 predicted 297
4 SASI_Hs01_00185401 predicted 496
5 SASI_Hs01_00185402 predicted 439
6 SASI_Hs01_00185403 predicted 497
7 SASI_Hs01_00185404 predicted 372
8 SASI_Hs01_00185405 predicted 693
9 SASI_Hs01_00185406 predicted 433
10 SASI_Hs01_00185407 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104818 predicted 463
2 SASI_Hs01_00104819 predicted 559
3 SASI_Hs01_00104820 predicted 310
4 SASI_Hs01_00104821 predicted 507
5 SASI_Hs01_00104822 predicted 449
6 SASI_Hs01_00104823 predicted 515
7 SASI_Hs01_00104824 predicted 387
8 SASI_Hs01_00104825 predicted 714
9 SASI_Hs01_00104826 predicted 446
10 SASI_Hs01_00104827 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107989 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234265 predicted 456
2 SASI_Rn02_00234266 predicted 472
3 SASI_Rn02_00234267 predicted 281
4 SASI_Rn02_00234268 predicted 349
5 SASI_Rn02_00234269 predicted 534
6 SASI_Rn02_00234270 predicted 544
7 SASI_Rn02_00234271 predicted 713
8 SASI_Rn02_00234272 predicted 404
9 SASI_Rn02_00234273 predicted 205
10 SASI_Rn02_00234274 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008546 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169765 predicted 700
2 SASI_Mm01_00169766 predicted 399
3 SASI_Mm01_00169767 predicted 499
4 SASI_Mm01_00169768 predicted 549
5 SASI_Mm01_00169769 predicted 327
6 SASI_Mm01_00169770 predicted 363
7 SASI_Mm01_00169771 predicted 512
8 SASI_Mm01_00169772 predicted 333
9 SASI_Mm01_00169773 predicted 502
10 SASI_Mm01_00169774 predicted 596
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002403
MFAP2 MISSION shRNA Bacterial Glycerol Stock
microfibrillar-associated protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002403.3-304s21c1
Sequence:CCGGCTCCGAGGAACAGTTCCAGTTCTCGAGAACTGGAACTGTTCCTCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002403.3-547s21c1
Sequence:CCGGTCGTACAGTGTGTGCCCATGACTCGAGTCATGGGCACACACTGTACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002403.3-229s21c1
Sequence:CCGGCGTCCAGTACACCCACTATAGCTCGAGCTATAGTGGGTGTACTGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002403.2-303s1c1
Sequence:CCGGGCAAGTCCAACAGGAAGTCATCTCGAGATGACTTCCTGTTGGACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002403.2-441s1c1
Sequence:CCGGCAAACAGTGTCTCAACGAGGTCTCGAGACCTCGTTGAGACACTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002403.2-480s1c1
Sequence:CCGGCCGTGTGTACGTCATTAACAACTCGAGTTGTTAATGACGTACACACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002403.2-226s1c1
Sequence:CCGGGACAACCCAGACTACTATGATCTCGAGATCATAGTAGTCTGGGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002403.2-486s1c1
Sequence:CCGGGTACGTCATTAACAAGGAGATCTCGAGATCTCCTTGTTAATGACGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002403.2-564s1c1
Sequence:CCGGCAAGTTCTCCAAATGTGGCGTCTCGAGACGCCACATTTGGAGAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002403.2-222s1c1
Sequence:CCGGGATCGACAACCCAGACTACTACTCGAGTAGTAGTCTGGGTTGTCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002403
MFAP2 MISSION shRNA shRNA Plasmid DNA
microfibrillar-associated protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002403.3-304s21c1
Sequence:CCGGCTCCGAGGAACAGTTCCAGTTCTCGAGAACTGGAACTGTTCCTCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002403.3-547s21c1
Sequence:CCGGTCGTACAGTGTGTGCCCATGACTCGAGTCATGGGCACACACTGTACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002403.3-229s21c1
Sequence:CCGGCGTCCAGTACACCCACTATAGCTCGAGCTATAGTGGGTGTACTGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002403.2-303s1c1
Sequence:CCGGGCAAGTCCAACAGGAAGTCATCTCGAGATGACTTCCTGTTGGACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002403.2-441s1c1
Sequence:CCGGCAAACAGTGTCTCAACGAGGTCTCGAGACCTCGTTGAGACACTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002403.2-480s1c1
Sequence:CCGGCCGTGTGTACGTCATTAACAACTCGAGTTGTTAATGACGTACACACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002403.2-226s1c1
Sequence:CCGGGACAACCCAGACTACTATGATCTCGAGATCATAGTAGTCTGGGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002403.2-486s1c1
Sequence:CCGGGTACGTCATTAACAAGGAGATCTCGAGATCTCCTTGTTAATGACGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002403.2-564s1c1
Sequence:CCGGCAAGTTCTCCAAATGTGGCGTCTCGAGACGCCACATTTGGAGAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002403.2-222s1c1
Sequence:CCGGGATCGACAACCCAGACTACTACTCGAGTAGTAGTCTGGGTTGTCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002403
MFAP2 MISSION shRNA Lentiviral Transduction Particles
microfibrillar-associated protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002403.3-304s21c1
Sequence:CCGGCTCCGAGGAACAGTTCCAGTTCTCGAGAACTGGAACTGTTCCTCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002403.3-547s21c1
Sequence:CCGGTCGTACAGTGTGTGCCCATGACTCGAGTCATGGGCACACACTGTACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002403.3-229s21c1
Sequence:CCGGCGTCCAGTACACCCACTATAGCTCGAGCTATAGTGGGTGTACTGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002403.2-303s1c1
Sequence:CCGGGCAAGTCCAACAGGAAGTCATCTCGAGATGACTTCCTGTTGGACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002403.2-441s1c1
Sequence:CCGGCAAACAGTGTCTCAACGAGGTCTCGAGACCTCGTTGAGACACTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002403.2-480s1c1
Sequence:CCGGCCGTGTGTACGTCATTAACAACTCGAGTTGTTAATGACGTACACACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002403.2-226s1c1
Sequence:CCGGGACAACCCAGACTACTATGATCTCGAGATCATAGTAGTCTGGGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002403.2-486s1c1
Sequence:CCGGGTACGTCATTAACAAGGAGATCTCGAGATCTCCTTGTTAATGACGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002403.2-564s1c1
Sequence:CCGGCAAGTTCTCCAAATGTGGCGTCTCGAGACGCCACATTTGGAGAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002403.2-222s1c1
Sequence:CCGGGATCGACAACCCAGACTACTACTCGAGTAGTAGTCTGGGTTGTCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008546
MFAP2 MISSION shRNA Bacterial Glycerol Stock
microfibrillar-associated protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008546.2-253s1c1
Sequence:CCGGGCAAGTTCAACAGGAAGTCATCTCGAGATGACTTCCTGTTGAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008546.2-175s1c1
Sequence:CCGGCCAGATTGACAACGCAGACTACTCGAGTAGTCTGCGTTGTCAATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008546.2-248s1c1
Sequence:CCGGCAGCAGCAAGTTCAACAGGAACTCGAGTTCCTGTTGAACTTGCTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008546.2-394s1c1
Sequence:CCGGGCCTTGCAAACAGTGTCTCAACTCGAGTTGAGACACTGTTTGCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008546.2-200s1c1
Sequence:CCGGGACTACCAAGAAGTGAGTCCTCTCGAGAGGACTCACTTCTTGGTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008546
MFAP2 MISSION shRNA shRNA Plasmid DNA
microfibrillar-associated protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008546.2-253s1c1
Sequence:CCGGGCAAGTTCAACAGGAAGTCATCTCGAGATGACTTCCTGTTGAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008546.2-175s1c1
Sequence:CCGGCCAGATTGACAACGCAGACTACTCGAGTAGTCTGCGTTGTCAATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008546.2-248s1c1
Sequence:CCGGCAGCAGCAAGTTCAACAGGAACTCGAGTTCCTGTTGAACTTGCTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008546.2-394s1c1
Sequence:CCGGGCCTTGCAAACAGTGTCTCAACTCGAGTTGAGACACTGTTTGCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008546.2-200s1c1
Sequence:CCGGGACTACCAAGAAGTGAGTCCTCTCGAGAGGACTCACTTCTTGGTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008546
MFAP2 MISSION shRNA Lentiviral Transduction Particles
microfibrillar-associated protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008546.2-253s1c1
Sequence:CCGGGCAAGTTCAACAGGAAGTCATCTCGAGATGACTTCCTGTTGAACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008546.2-175s1c1
Sequence:CCGGCCAGATTGACAACGCAGACTACTCGAGTAGTCTGCGTTGTCAATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008546.2-248s1c1
Sequence:CCGGCAGCAGCAAGTTCAACAGGAACTCGAGTTCCTGTTGAACTTGCTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008546.2-394s1c1
Sequence:CCGGGCCTTGCAAACAGTGTCTCAACTCGAGTTGAGACACTGTTTGCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008546.2-200s1c1
Sequence:CCGGGACTACCAAGAAGTGAGTCCTCTCGAGAGGACTCACTTCTTGGTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)