EMAIL THIS PAGE TO A FRIEND

MFAP3

microfibrillar-associated protein 3

125 Gene Product Result for
UniProtKB ID: P55082, B2RDK0, B4DKA1, Q9NXA7
Gene ID:
Mouse(216760) microfibrillar-associated protein 3
Rat(287299) microfibrillar-associated protein 3
naked mole-rat(101723164) microfibrillar-associated protein 3
Domestic Rabbit(100349136) microfibrillar-associated protein 3
domestic guinea pig(100727599) microfibrillar-associated protein 3
sheep(101109270) microfibrillar-associated protein 3
chicken(416261) microfibrillar-associated protein 3
cow(317721) microfibrillar-associated protein 3
Horse(100071417) microfibrillar-associated protein 3
domestic cat(101097378) microfibrillar-associated protein 3
dog(489166) microfibrillar-associated protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005927 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005927 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005927 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145426 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145426 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145426 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005927 Rosetta Predictions human pricing
NM_001007609 Rosetta Predictions rat pricing
NM_145426 Rosetta Predictions mouse pricing
NM_180599 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044465 predicted 663
2 SASI_Hs02_00340572 predicted 1155
3 SASI_Hs01_00044466 predicted 1621
4 SASI_Hs01_00044467 predicted 662
5 SASI_Hs01_00044468 predicted 766
6 SASI_Hs01_00044469 predicted 700
7 SASI_Hs01_00044470 predicted 570
8 SASI_Hs01_00044471 predicted 1020
9 SASI_Hs01_00044472 predicted 902
10 SASI_Hs02_00340573 predicted 1478
11 SASI_Hs01_00044473 predicted 1470
12 SASI_Hs01_00044474 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007609 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092842 predicted 1277
2 SASI_Rn01_00092843 predicted 270
3 SASI_Rn01_00092845 predicted 767
4 SASI_Rn01_00092846 predicted 483
5 SASI_Rn02_00198694 predicted 359
6 SASI_Rn01_00092847 predicted 1318
7 SASI_Rn01_00092848 predicted 831
8 SASI_Rn01_00092850 predicted 763
9 SASI_Rn01_00092851 predicted 1005
10 SASI_Rn02_00198695 predicted 1282
11 SASI_Rn01_00092844 predicted 1045
12 SASI_Rn01_00092849 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110307 predicted 644
2 SASI_Mm01_00110308 predicted 964
3 SASI_Mm01_00110309 predicted 527
4 SASI_Mm01_00110311 predicted 876
5 SASI_Mm01_00110312 predicted 656
6 SASI_Mm01_00110313 predicted 328
7 SASI_Mm01_00110314 predicted 560
8 SASI_Mm01_00110315 predicted 1046
9 SASI_Mm01_00110316 predicted 1097
10 SASI_Mm02_00340778 predicted 334
11 SASI_Mm01_00110310 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_180599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127177 predicted 613
2 SASI_Mm01_00127178 predicted 931
3 SASI_Mm01_00127179 predicted 490
4 SASI_Mm01_00127181 predicted 846
5 SASI_Mm01_00127182 predicted 621
6 SASI_Mm01_00127183 predicted 292
7 SASI_Mm01_00127184 predicted 520
8 SASI_Mm01_00127185 predicted 1013
9 SASI_Mm01_00127186 predicted 1060
10 SASI_Mm02_00349578 predicted 293
11 SASI_Mm01_00127180 predicted 498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005927
VALIDATED
MFAP3 MISSION shRNA Bacterial Glycerol Stock
microfibrillar-associated protein 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005927.3-1620s1c1
Sequence:CCGGCCTGTTTCTTAGAAGAAGTAACTCGAGTTACTTCTTCTAAGAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005927.3-579s1c1
Sequence:CCGGGCAAATCGTAGTTCTTACAATCTCGAGATTGTAAGAACTACGATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005927.3-1125s1c1
Sequence:CCGGCTCGCCAAAGTCACACAATTTCTCGAGAAATTGTGTGACTTTGGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005927.3-1124s1c1
Sequence:CCGGGCTCGCCAAAGTCACACAATTCTCGAGAATTGTGTGACTTTGGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005927.3-1224s1c1
Sequence:CCGGGCCTTTGTTGAGGAGATGTTTCTCGAGAAACATCTCCTCAACAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005927.4-867s21c1
Sequence:CCGGGCTCGCCAAAGTCACACAATTCTCGAGAATTGTGTGACTTTGGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005927.4-1363s21c1
Sequence:CCGGCCTGTTTCTTAGAAGAAGTAACTCGAGTTACTTCTTCTAAGAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005927.4-967s21c1
Sequence:CCGGGCCTTTGTTGAGGAGATGTTTCTCGAGAAACATCTCCTCAACAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005927.4-322s21c1
Sequence:CCGGGCAAATCGTAGTTCTTACAATCTCGAGATTGTAAGAACTACGATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005927
VALIDATED
MFAP3 MISSION shRNA shRNA Plasmid DNA
microfibrillar-associated protein 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005927.3-1620s1c1
Sequence:CCGGCCTGTTTCTTAGAAGAAGTAACTCGAGTTACTTCTTCTAAGAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005927.3-579s1c1
Sequence:CCGGGCAAATCGTAGTTCTTACAATCTCGAGATTGTAAGAACTACGATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005927.3-1125s1c1
Sequence:CCGGCTCGCCAAAGTCACACAATTTCTCGAGAAATTGTGTGACTTTGGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005927.3-1124s1c1
Sequence:CCGGGCTCGCCAAAGTCACACAATTCTCGAGAATTGTGTGACTTTGGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005927.3-1224s1c1
Sequence:CCGGGCCTTTGTTGAGGAGATGTTTCTCGAGAAACATCTCCTCAACAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005927.4-867s21c1
Sequence:CCGGGCTCGCCAAAGTCACACAATTCTCGAGAATTGTGTGACTTTGGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005927.4-1363s21c1
Sequence:CCGGCCTGTTTCTTAGAAGAAGTAACTCGAGTTACTTCTTCTAAGAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005927.4-967s21c1
Sequence:CCGGGCCTTTGTTGAGGAGATGTTTCTCGAGAAACATCTCCTCAACAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005927.4-322s21c1
Sequence:CCGGGCAAATCGTAGTTCTTACAATCTCGAGATTGTAAGAACTACGATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005927
VALIDATED
MFAP3 MISSION shRNA Lentiviral Transduction Particles
microfibrillar-associated protein 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005927.3-1620s1c1
Sequence:CCGGCCTGTTTCTTAGAAGAAGTAACTCGAGTTACTTCTTCTAAGAAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005927.3-579s1c1
Sequence:CCGGGCAAATCGTAGTTCTTACAATCTCGAGATTGTAAGAACTACGATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005927.3-1125s1c1
Sequence:CCGGCTCGCCAAAGTCACACAATTTCTCGAGAAATTGTGTGACTTTGGCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005927.3-1124s1c1
Sequence:CCGGGCTCGCCAAAGTCACACAATTCTCGAGAATTGTGTGACTTTGGCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005927.3-1224s1c1
Sequence:CCGGGCCTTTGTTGAGGAGATGTTTCTCGAGAAACATCTCCTCAACAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005927.4-867s21c1
Sequence:CCGGGCTCGCCAAAGTCACACAATTCTCGAGAATTGTGTGACTTTGGCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005927.4-1363s21c1
Sequence:CCGGCCTGTTTCTTAGAAGAAGTAACTCGAGTTACTTCTTCTAAGAAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005927.4-967s21c1
Sequence:CCGGGCCTTTGTTGAGGAGATGTTTCTCGAGAAACATCTCCTCAACAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005927.4-322s21c1
Sequence:CCGGGCAAATCGTAGTTCTTACAATCTCGAGATTGTAAGAACTACGATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145426
VALIDATED
MFAP3 MISSION shRNA Bacterial Glycerol Stock
microfibrillar-associated protein 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145426.1-1284s1c1
Sequence:CCGGGCCTGCTATGAGAATAACATACTCGAGTATGTTATTCTCATAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145426.1-853s1c1
Sequence:CCGGCCATGGAGTTTGCCCGATATACTCGAGTATATCGGGCAAACTCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145426.1-650s1c1
Sequence:CCGGCGCCTTCACAATCACACTCATCTCGAGATGAGTGTGATTGTGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145426.1-309s1c1
Sequence:CCGGGCATCATTTCTCCCAAGCTTTCTCGAGAAAGCTTGGGAGAAATGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145426.2-1674s21c1
Sequence:CCGGGACCTTATTCTGCACTCTAATCTCGAGATTAGAGTGCAGAATAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145426.2-568s21c1
Sequence:CCGGTGATGACCGTGGGCTCTATACCTCGAGGTATAGAGCCCACGGTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145426.1-1013s1c1
Sequence:CCGGCGCTCAAAGTGGCATCTATGTCTCGAGACATAGATGCCACTTTGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145426.2-1358s21c1
Sequence:CCGGGGTCTTCCCGTTAACCTTAAACTCGAGTTTAAGGTTAACGGGAAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145426.2-447s21c1
Sequence:CCGGTTCTCACGGTGGATCAGTATGCTCGAGCATACTGATCCACCGTGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145426.2-1210s21c1
Sequence:CCGGTTCTCAAGACAGTAGTCATTTCTCGAGAAATGACTACTGTCTTGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145426.2-399s21c1
Sequence:CCGGATGATGTCATTATAGTCAAAGCTCGAGCTTTGACTATAATGACATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145426
VALIDATED
MFAP3 MISSION shRNA shRNA Plasmid DNA
microfibrillar-associated protein 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145426.1-1284s1c1
Sequence:CCGGGCCTGCTATGAGAATAACATACTCGAGTATGTTATTCTCATAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145426.1-853s1c1
Sequence:CCGGCCATGGAGTTTGCCCGATATACTCGAGTATATCGGGCAAACTCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145426.1-650s1c1
Sequence:CCGGCGCCTTCACAATCACACTCATCTCGAGATGAGTGTGATTGTGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145426.1-309s1c1
Sequence:CCGGGCATCATTTCTCCCAAGCTTTCTCGAGAAAGCTTGGGAGAAATGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145426.2-1674s21c1
Sequence:CCGGGACCTTATTCTGCACTCTAATCTCGAGATTAGAGTGCAGAATAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145426.2-568s21c1
Sequence:CCGGTGATGACCGTGGGCTCTATACCTCGAGGTATAGAGCCCACGGTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145426.1-1013s1c1
Sequence:CCGGCGCTCAAAGTGGCATCTATGTCTCGAGACATAGATGCCACTTTGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145426.2-1358s21c1
Sequence:CCGGGGTCTTCCCGTTAACCTTAAACTCGAGTTTAAGGTTAACGGGAAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145426.2-447s21c1
Sequence:CCGGTTCTCACGGTGGATCAGTATGCTCGAGCATACTGATCCACCGTGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145426.2-1210s21c1
Sequence:CCGGTTCTCAAGACAGTAGTCATTTCTCGAGAAATGACTACTGTCTTGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145426.2-399s21c1
Sequence:CCGGATGATGTCATTATAGTCAAAGCTCGAGCTTTGACTATAATGACATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145426
VALIDATED
MFAP3 MISSION shRNA Lentiviral Transduction Particles
microfibrillar-associated protein 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145426.1-1284s1c1
Sequence:CCGGGCCTGCTATGAGAATAACATACTCGAGTATGTTATTCTCATAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145426.1-853s1c1
Sequence:CCGGCCATGGAGTTTGCCCGATATACTCGAGTATATCGGGCAAACTCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145426.1-650s1c1
Sequence:CCGGCGCCTTCACAATCACACTCATCTCGAGATGAGTGTGATTGTGAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145426.1-309s1c1
Sequence:CCGGGCATCATTTCTCCCAAGCTTTCTCGAGAAAGCTTGGGAGAAATGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145426.2-1674s21c1
Sequence:CCGGGACCTTATTCTGCACTCTAATCTCGAGATTAGAGTGCAGAATAAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145426.2-568s21c1
Sequence:CCGGTGATGACCGTGGGCTCTATACCTCGAGGTATAGAGCCCACGGTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145426.1-1013s1c1
Sequence:CCGGCGCTCAAAGTGGCATCTATGTCTCGAGACATAGATGCCACTTTGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145426.2-1358s21c1
Sequence:CCGGGGTCTTCCCGTTAACCTTAAACTCGAGTTTAAGGTTAACGGGAAGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145426.2-447s21c1
Sequence:CCGGTTCTCACGGTGGATCAGTATGCTCGAGCATACTGATCCACCGTGAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145426.2-1210s21c1
Sequence:CCGGTTCTCAAGACAGTAGTCATTTCTCGAGAAATGACTACTGTCTTGAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145426.2-399s21c1
Sequence:CCGGATGATGTCATTATAGTCAAAGCTCGAGCTTTGACTATAATGACATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)