EMAIL THIS PAGE TO A FRIEND

MFAP3L

microfibrillar-associated protein 3-like

180 Gene Product Result for
Synonyms: NYD-sp9
Gene ID:
Mouse(71306) microfibrillar-associated protein 3-like
Rat(306424) microfibrillar-associated protein 3-like
chicken(428729) microfibrillar-associated protein 3-like
domestic cat(101092022) microfibrillar-associated protein 3-like
cow(529443) microfibrillar-associated protein 3-like
Horse(100067185) microfibrillar-associated protein 3-like
dog(477356) microfibrillar-associated protein 3-like
sheep(101121914) microfibrillar-associated protein 3-like
domestic guinea pig(100728231) microfibrillar-associated protein 3-like
Domestic Rabbit(100355353) microfibrillar-associated protein 3-like
naked mole-rat(101706384) microfibrillar-associated protein 3-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021647 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021647 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021647 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027756 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027756 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027756 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009554 Rosetta Predictions human pricing
NM_021647 Rosetta Predictions human pricing
NM_001012049 Rosetta Predictions rat pricing
XM_573901 Rosetta Predictions rat pricing
NM_027756 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305617 predicted 1245
2 SASI_Hs02_00305618 predicted 567
3 SASI_Hs02_00305619 predicted 930
4 SASI_Hs02_00305620 predicted 1015
5 SASI_Hs02_00305621 predicted 755
6 SASI_Hs02_00305622 predicted 1341
7 SASI_Hs02_00305623 predicted 853
8 SASI_Hs02_00305624 predicted 1312
9 SASI_Hs02_00305625 predicted 760
10 SASI_Hs02_00305626 predicted 1019
11 SASI_Hs01_00136250 predicted 381
12 SASI_Hs01_00136251 predicted 406
13 SASI_Hs01_00136252 predicted 360
14 SASI_Hs01_00136253 predicted 485
15 SASI_Hs01_00136254 predicted 651
16 SASI_Hs01_00136255 predicted 323
17 SASI_Hs01_00136256 predicted 337
18 SASI_Hs01_00136257 predicted 498
19 SASI_Hs01_00136258 predicted 470
20 SASI_Hs01_00136259 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355017 predicted 1607
2 SASI_Hs02_00355018 predicted 920
3 SASI_Hs02_00355019 predicted 1298
4 SASI_Hs02_00355020 predicted 1375
5 SASI_Hs02_00355021 predicted 1117
6 SASI_Hs02_00355022 predicted 1703
7 SASI_Hs02_00355023 predicted 1211
8 SASI_Hs02_00355024 predicted 1676
9 SASI_Hs02_00355025 predicted 1120
10 SASI_Hs02_00355026 predicted 1382
11 SASI_Hs01_00216413 predicted 681
12 SASI_Hs01_00216414 predicted 706
13 SASI_Hs01_00216415 predicted 659
14 SASI_Hs01_00216416 predicted 787
15 SASI_Hs01_00216417 predicted 956
16 SASI_Hs01_00216418 predicted 632
17 SASI_Hs01_00216419 predicted 644
18 SASI_Hs01_00216420 predicted 796
19 SASI_Hs01_00216421 predicted 766
20 SASI_Hs01_00216422 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012049 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033601 predicted 507
2 SASI_Rn01_00033602 predicted 649
3 SASI_Rn01_00033603 predicted 958
4 SASI_Rn01_00033604 predicted 833
5 SASI_Rn01_00033605 predicted 1117
6 SASI_Rn01_00033606 predicted 1472
7 SASI_Rn01_00033608 predicted 660
8 SASI_Rn01_00033609 predicted 1217
9 SASI_Rn02_00200152 predicted 433
10 SASI_Rn02_00200153 predicted 925
11 SASI_Rn01_00033607 predicted 946
12 SASI_Rn01_00033610 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573901 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00171477 predicted 301
2 SASI_Rn01_00171478 predicted 300
3 SASI_Rn01_00171479 predicted 300
4 SASI_Rn01_00171480 predicted 305
5 SASI_Rn01_00171481 predicted 322
6 SASI_Rn01_00171482 predicted 299
7 SASI_Rn01_00171483 predicted 294
8 SASI_Rn01_00171484 predicted 293
9 SASI_Rn01_00171485 predicted 507
10 SASI_Rn01_00171486 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034925 predicted 986
2 SASI_Mm02_00332702 predicted 517
3 SASI_Mm01_00034928 predicted 963
4 SASI_Mm01_00034929 predicted 540
5 SASI_Mm02_00332703 predicted 1504
6 SASI_Mm02_00332704 predicted 1153
7 SASI_Mm01_00034931 predicted 1532
8 SASI_Mm01_00034932 predicted 1245
9 SASI_Mm02_00332705 predicted 680
10 SASI_Mm02_00332706 predicted 465
11 SASI_Mm01_00034924 predicted 754
12 SASI_Mm01_00034926 predicted 1157
13 SASI_Mm01_00034927 predicted 1116
14 SASI_Mm01_00034930 predicted 1510
15 SASI_Mm01_00034933 predicted 687
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021647
MFAP3L MISSION shRNA Bacterial Glycerol Stock
microfibrillar-associated protein 3-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021647.6-525s21c1
Sequence:CCGGCCTTCTCAGACCGAGGTAAATCTCGAGATTTACCTCGGTCTGAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021647.6-1390s21c1
Sequence:CCGGTTACGAAAGCCATGTCTAATACTCGAGTATTAGACATGGCTTTCGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021647.6-665s21c1
Sequence:CCGGATCGTCATGGTCCTCAATATCCTCGAGGATATTGAGGACCATGACGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021647.5-337s1c1
Sequence:CCGGCCACAGTTCAAGTGGTATAATCTCGAGATTATACCACTTGAACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021647.5-262s1c1
Sequence:CCGGGCCAGAACTGACCATATCATACTCGAGTATGATATGGTCAGTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021647.5-483s1c1
Sequence:CCGGGTGTGTGGCTTCTAACATCTACTCGAGTAGATGTTAGAAGCCACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021647.5-301s1c1
Sequence:CCGGGCCTTGATTAACTGTAGTGTTCTCGAGAACACTACAGTTAATCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021647.5-861s1c1
Sequence:CCGGCAGGACTATCATGGAGGAGATCTCGAGATCTCCTCCATGATAGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021647
MFAP3L MISSION shRNA shRNA Plasmid DNA
microfibrillar-associated protein 3-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021647.6-525s21c1
Sequence:CCGGCCTTCTCAGACCGAGGTAAATCTCGAGATTTACCTCGGTCTGAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021647.6-1390s21c1
Sequence:CCGGTTACGAAAGCCATGTCTAATACTCGAGTATTAGACATGGCTTTCGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021647.6-665s21c1
Sequence:CCGGATCGTCATGGTCCTCAATATCCTCGAGGATATTGAGGACCATGACGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021647.5-337s1c1
Sequence:CCGGCCACAGTTCAAGTGGTATAATCTCGAGATTATACCACTTGAACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021647.5-262s1c1
Sequence:CCGGGCCAGAACTGACCATATCATACTCGAGTATGATATGGTCAGTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021647.5-483s1c1
Sequence:CCGGGTGTGTGGCTTCTAACATCTACTCGAGTAGATGTTAGAAGCCACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021647.5-301s1c1
Sequence:CCGGGCCTTGATTAACTGTAGTGTTCTCGAGAACACTACAGTTAATCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021647.5-861s1c1
Sequence:CCGGCAGGACTATCATGGAGGAGATCTCGAGATCTCCTCCATGATAGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021647
MFAP3L MISSION shRNA Lentiviral Transduction Particles
microfibrillar-associated protein 3-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021647.6-525s21c1
Sequence:CCGGCCTTCTCAGACCGAGGTAAATCTCGAGATTTACCTCGGTCTGAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021647.6-1390s21c1
Sequence:CCGGTTACGAAAGCCATGTCTAATACTCGAGTATTAGACATGGCTTTCGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021647.6-665s21c1
Sequence:CCGGATCGTCATGGTCCTCAATATCCTCGAGGATATTGAGGACCATGACGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021647.5-337s1c1
Sequence:CCGGCCACAGTTCAAGTGGTATAATCTCGAGATTATACCACTTGAACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021647.5-262s1c1
Sequence:CCGGGCCAGAACTGACCATATCATACTCGAGTATGATATGGTCAGTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021647.5-483s1c1
Sequence:CCGGGTGTGTGGCTTCTAACATCTACTCGAGTAGATGTTAGAAGCCACACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021647.5-301s1c1
Sequence:CCGGGCCTTGATTAACTGTAGTGTTCTCGAGAACACTACAGTTAATCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021647.5-861s1c1
Sequence:CCGGCAGGACTATCATGGAGGAGATCTCGAGATCTCCTCCATGATAGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027756
MFAP3L MISSION shRNA Bacterial Glycerol Stock
microfibrillar-associated protein 3-like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027756.3-1216s21c1
Sequence:CCGGGACTCGGATGCTTCGTCATTGCTCGAGCAATGACGAAGCATCCGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027756.3-995s21c1
Sequence:CCGGTGGAATTTGCTAGGTACATTGCTCGAGCAATGTACCTAGCAAATTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027756.3-753s21c1
Sequence:CCGGAGACATGGGCGTGTACTATATCTCGAGATATAGTACACGCCCATGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027756.2-1995s1c1
Sequence:CCGGCCGTTCTTTCCTAATGGAGTACTCGAGTACTCCATTAGGAAAGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027756.2-695s1c1
Sequence:CCGGCTAACATCTATGGCACTATAACTCGAGTTATAGTGCCATAGATGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027756.2-1349s1c1
Sequence:CCGGCAGAACCATCAGAGGAACATTCTCGAGAATGTTCCTCTGATGGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027756.2-658s1c1
Sequence:CCGGTCTTTCTCAGACAGAGGTAAACTCGAGTTTACCTCTGTCTGAGAAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027756.2-537s1c1
Sequence:CCGGCCTAGAGTTTAAGTGGTATAACTCGAGTTATACCACTTAAACTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027756
MFAP3L MISSION shRNA shRNA Plasmid DNA
microfibrillar-associated protein 3-like
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027756.3-1216s21c1
Sequence:CCGGGACTCGGATGCTTCGTCATTGCTCGAGCAATGACGAAGCATCCGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027756.3-995s21c1
Sequence:CCGGTGGAATTTGCTAGGTACATTGCTCGAGCAATGTACCTAGCAAATTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027756.3-753s21c1
Sequence:CCGGAGACATGGGCGTGTACTATATCTCGAGATATAGTACACGCCCATGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027756.2-1995s1c1
Sequence:CCGGCCGTTCTTTCCTAATGGAGTACTCGAGTACTCCATTAGGAAAGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027756.2-695s1c1
Sequence:CCGGCTAACATCTATGGCACTATAACTCGAGTTATAGTGCCATAGATGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027756.2-1349s1c1
Sequence:CCGGCAGAACCATCAGAGGAACATTCTCGAGAATGTTCCTCTGATGGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027756.2-658s1c1
Sequence:CCGGTCTTTCTCAGACAGAGGTAAACTCGAGTTTACCTCTGTCTGAGAAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027756.2-537s1c1
Sequence:CCGGCCTAGAGTTTAAGTGGTATAACTCGAGTTATACCACTTAAACTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027756
MFAP3L MISSION shRNA Lentiviral Transduction Particles
microfibrillar-associated protein 3-like
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027756.3-1216s21c1
Sequence:CCGGGACTCGGATGCTTCGTCATTGCTCGAGCAATGACGAAGCATCCGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027756.3-995s21c1
Sequence:CCGGTGGAATTTGCTAGGTACATTGCTCGAGCAATGTACCTAGCAAATTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027756.3-753s21c1
Sequence:CCGGAGACATGGGCGTGTACTATATCTCGAGATATAGTACACGCCCATGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027756.2-1995s1c1
Sequence:CCGGCCGTTCTTTCCTAATGGAGTACTCGAGTACTCCATTAGGAAAGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027756.2-695s1c1
Sequence:CCGGCTAACATCTATGGCACTATAACTCGAGTTATAGTGCCATAGATGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027756.2-1349s1c1
Sequence:CCGGCAGAACCATCAGAGGAACATTCTCGAGAATGTTCCTCTGATGGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027756.2-658s1c1
Sequence:CCGGTCTTTCTCAGACAGAGGTAAACTCGAGTTTACCTCTGTCTGAGAAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027756.2-537s1c1
Sequence:CCGGCCTAGAGTTTAAGTGGTATAACTCGAGTTATACCACTTAAACTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)