EMAIL THIS PAGE TO A FRIEND

MFAP4

microfibrillar-associated protein 4

66 Gene Product Result for
UniProtKB ID: P55083, A8KAJ1, A8MVM2, B4E317, Q6P680
Gene ID:
Human(4239) Summary: This gene encodes a protein with similarity to a bovine microfibril-associated protein. The protein has binding specificities for both collagen and carbohydrate. It is thought to be an extracellular matrix protein which is involved in cell adhesion or intercellular interactions. The gene is located within the Smith-Magenis syndrome region. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Mouse(76293) microfibrillar-associated protein 4
Rat(287382) microfibrillar-associated protein 4
naked mole-rat(101696729) microfibrillar-associated protein 4
domestic guinea pig(100714458) microfibrillar-associated protein 4
sheep(101109814) microfibrillar-associated protein 4
Zebrafish(405825) microfibrillar-associated protein 4
cow(286766) microfibrillar-associated protein 4
chicken(428662) microfibrillar-associated protein 4
domestic cat(101085505) microfibrillar-associated protein 4
dog(489531) microfibrillar-associated protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002404 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002404 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002404 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029568 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029568 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029568 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002404 Rosetta Predictions human pricing
NM_001034124 Rosetta Predictions rat pricing
NM_029568 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160464 predicted 1138
2 SASI_Hs01_00160465 predicted 1174
3 SASI_Hs01_00160467 predicted 729
4 SASI_Hs01_00160470 predicted 504
5 SASI_Hs01_00160471 predicted 709
6 SASI_Hs01_00160472 predicted 406
7 SASI_Hs02_00333776 predicted 944
8 SASI_Hs02_00333777 predicted 1132
9 SASI_Hs01_00160463 predicted 271
10 SASI_Hs01_00160466 predicted 542
11 SASI_Hs01_00160468 predicted 389
12 SASI_Hs01_00160469 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034124 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203954 predicted 1130
2 SASI_Rn01_00119975 predicted 1010
3 SASI_Rn01_00119976 predicted 373
4 SASI_Rn01_00119977 predicted 746
5 SASI_Rn01_00119978 predicted 984
6 SASI_Rn01_00119979 predicted 1224
7 SASI_Rn01_00119981 predicted 436
8 SASI_Rn01_00119982 predicted 705
9 SASI_Rn02_00203955 predicted 734
10 SASI_Rn01_00119983 predicted 540
11 SASI_Rn01_00119980 predicted 1060
12 SASI_Rn01_00119984 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029568 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156553 predicted 735
2 SASI_Mm01_00156554 predicted 526
3 SASI_Mm01_00156555 predicted 453
4 SASI_Mm01_00156556 predicted 395
5 SASI_Mm01_00156557 predicted 772
6 SASI_Mm01_00156558 predicted 732
7 SASI_Mm01_00156559 predicted 1257
8 SASI_Mm01_00156560 predicted 745
9 SASI_Mm01_00156561 predicted 905
10 SASI_Mm01_00156562 predicted 701
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002404
MFAP4 MISSION shRNA Bacterial Glycerol Stock
microfibrillar-associated protein 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002404.1-383s1c1
Sequence:CCGGCTGACACTGAAGCAGAAGTATCTCGAGATACTTCTGCTTCAGTGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002404.1-1223s21c1
Sequence:CCGGGAACAGGGCCCATGGTGTATTCTCGAGAATACACCATGGGCCCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119147    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002404.1-1354s1c1
Sequence:CCGGCCTCACTATCATACTCAGCTTCTCGAGAAGCTGAGTATGATAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002404.1-382s1c1
Sequence:CCGGCCTGACACTGAAGCAGAAGTACTCGAGTACTTCTGCTTCAGTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002404.1-313s1c1
Sequence:CCGGGAATGACTACAAGCTGGGCTTCTCGAGAAGCCCAGCTTGTAGTCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002404.1-445s1c1
Sequence:CCGGCTATGCCAAGTACGCTGACTTCTCGAGAAGTCAGCGTACTTGGCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002404.1-281s21c1
Sequence:CCGGTTCAATGGCTCAGTAAGTTTCCTCGAGGAAACTTACTGAGCCATTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002404.1-141s21c1
Sequence:CCGGTGGACTGTGACGACATCTATGCTCGAGCATAGATGTCGTCACAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002404
MFAP4 MISSION shRNA shRNA Plasmid DNA
microfibrillar-associated protein 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002404.1-383s1c1
Sequence:CCGGCTGACACTGAAGCAGAAGTATCTCGAGATACTTCTGCTTCAGTGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002404.1-1223s21c1
Sequence:CCGGGAACAGGGCCCATGGTGTATTCTCGAGAATACACCATGGGCCCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119147    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002404.1-1354s1c1
Sequence:CCGGCCTCACTATCATACTCAGCTTCTCGAGAAGCTGAGTATGATAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002404.1-382s1c1
Sequence:CCGGCCTGACACTGAAGCAGAAGTACTCGAGTACTTCTGCTTCAGTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002404.1-313s1c1
Sequence:CCGGGAATGACTACAAGCTGGGCTTCTCGAGAAGCCCAGCTTGTAGTCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002404.1-445s1c1
Sequence:CCGGCTATGCCAAGTACGCTGACTTCTCGAGAAGTCAGCGTACTTGGCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002404.1-281s21c1
Sequence:CCGGTTCAATGGCTCAGTAAGTTTCCTCGAGGAAACTTACTGAGCCATTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002404.1-141s21c1
Sequence:CCGGTGGACTGTGACGACATCTATGCTCGAGCATAGATGTCGTCACAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002404
MFAP4 MISSION shRNA Lentiviral Transduction Particles
microfibrillar-associated protein 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002404.1-383s1c1
Sequence:CCGGCTGACACTGAAGCAGAAGTATCTCGAGATACTTCTGCTTCAGTGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002404.1-1223s21c1
Sequence:CCGGGAACAGGGCCCATGGTGTATTCTCGAGAATACACCATGGGCCCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119147    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002404.1-1354s1c1
Sequence:CCGGCCTCACTATCATACTCAGCTTCTCGAGAAGCTGAGTATGATAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002404.1-382s1c1
Sequence:CCGGCCTGACACTGAAGCAGAAGTACTCGAGTACTTCTGCTTCAGTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002404.1-313s1c1
Sequence:CCGGGAATGACTACAAGCTGGGCTTCTCGAGAAGCCCAGCTTGTAGTCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002404.1-445s1c1
Sequence:CCGGCTATGCCAAGTACGCTGACTTCTCGAGAAGTCAGCGTACTTGGCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002404.1-281s21c1
Sequence:CCGGTTCAATGGCTCAGTAAGTTTCCTCGAGGAAACTTACTGAGCCATTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002404.1-141s21c1
Sequence:CCGGTGGACTGTGACGACATCTATGCTCGAGCATAGATGTCGTCACAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029568
MFAP4 MISSION shRNA Bacterial Glycerol Stock
microfibrillar-associated protein 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029568.1-127s1c1
Sequence:CCGGGCTCTGGAGAAGTCCTGTCTTCTCGAGAAGACAGGACTTCTCCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029568.1-749s1c1
Sequence:CCGGCCCAATGGAAAGGCTTCTATTCTCGAGAATAGAAGCCTTTCCATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029568.1-1237s1c1
Sequence:CCGGCCTCAGAATACTTCCTACCTTCTCGAGAAGGTAGGAAGTATTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029568.1-684s1c1
Sequence:CCGGCGCCAATCTCAACGGTTTCTACTCGAGTAGAAACCGTTGAGATTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029568.1-457s1c1
Sequence:CCGGACAGCCTATGCCAAGTACATTCTCGAGAATGTACTTGGCATAGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029568
MFAP4 MISSION shRNA shRNA Plasmid DNA
microfibrillar-associated protein 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029568.1-127s1c1
Sequence:CCGGGCTCTGGAGAAGTCCTGTCTTCTCGAGAAGACAGGACTTCTCCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029568.1-749s1c1
Sequence:CCGGCCCAATGGAAAGGCTTCTATTCTCGAGAATAGAAGCCTTTCCATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029568.1-1237s1c1
Sequence:CCGGCCTCAGAATACTTCCTACCTTCTCGAGAAGGTAGGAAGTATTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029568.1-684s1c1
Sequence:CCGGCGCCAATCTCAACGGTTTCTACTCGAGTAGAAACCGTTGAGATTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029568.1-457s1c1
Sequence:CCGGACAGCCTATGCCAAGTACATTCTCGAGAATGTACTTGGCATAGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029568
MFAP4 MISSION shRNA Lentiviral Transduction Particles
microfibrillar-associated protein 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029568.1-127s1c1
Sequence:CCGGGCTCTGGAGAAGTCCTGTCTTCTCGAGAAGACAGGACTTCTCCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029568.1-749s1c1
Sequence:CCGGCCCAATGGAAAGGCTTCTATTCTCGAGAATAGAAGCCTTTCCATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029568.1-1237s1c1
Sequence:CCGGCCTCAGAATACTTCCTACCTTCTCGAGAAGGTAGGAAGTATTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029568.1-684s1c1
Sequence:CCGGCGCCAATCTCAACGGTTTCTACTCGAGTAGAAACCGTTGAGATTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029568.1-457s1c1
Sequence:CCGGACAGCCTATGCCAAGTACATTCTCGAGAATGTACTTGGCATAGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)