EMAIL THIS PAGE TO A FRIEND

MFAP5

microfibrillar associated protein 5

159 Gene Product Result for
Synonyms: MAGP2 MP25
UniProtKB ID: Q13361, B0AZL6, D3DUV1
Gene ID:
Human(8076) Summary: This gene encodes a 25-kD microfibril-associated glycoprotein which is rich in serine and threonine residues. It lacks a hydrophobic carboxyl terminus and proline-, glutamine-, and tyrosine-rich regions, which are characteristics of a related 31-kDa microfibril-associated glycoprotein (MFAP2). The close similarity between these two proteins is confined to a central region of 60 aa where precise alignment of 7 cysteine residues occurs. The structural differences suggest that this encoded protein has some functions that are distinct from those of MFAP2. [provided by RefSeq, Jul 2008]
Mouse(50530) microfibrillar associated protein 5
Rat(362429) microfibrillar associated protein 5
Zebrafish(100536858) microfibrillar associated protein 5
cow(281908) microfibrillar associated protein 5
domestic cat(101097495) microfibrillar associated protein 5
dog(477701) microfibrillar associated protein 5
chicken(418256) microfibrillar associated protein 5
sheep(101102052) microfibrillar associated protein 5
domestic guinea pig(100729361) microfibrillar associated protein 5
naked mole-rat(101708080) microfibrillar associated protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1572 Human MAGP-2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003480 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003480 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003480 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015776 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015776 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015776 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003480 Rosetta Predictions human pricing
NM_001108644 Rosetta Predictions rat pricing
NM_015776 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048710 predicted 995
2 SASI_Hs01_00048711 predicted 926
3 SASI_Hs01_00048712 predicted 552
4 SASI_Hs01_00048713 predicted 355
5 SASI_Hs01_00048714 predicted 531
6 SASI_Hs01_00048715 predicted 538
7 SASI_Hs01_00048716 predicted 794
8 SASI_Hs01_00048717 predicted 820
9 SASI_Hs01_00048718 predicted 506
10 SASI_Hs02_00335742 predicted 980
11 SASI_Hs01_00048719 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108644 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240659 predicted 254
2 SASI_Rn02_00240660 predicted 518
3 SASI_Rn02_00240661 predicted 379
4 SASI_Rn02_00240662 predicted 227
5 SASI_Rn02_00240663 predicted 462
6 SASI_Rn02_00240664 predicted 449
7 SASI_Rn02_00240665 predicted 381
8 SASI_Rn02_00240666 predicted 263
9 SASI_Rn02_00240667 predicted 247
10 SASI_Rn02_00240668 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015776 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194108 predicted 368
2 SASI_Mm01_00194109 predicted 359
3 SASI_Mm01_00194110 predicted 340
4 SASI_Mm01_00194111 predicted 290
5 SASI_Mm01_00194112 predicted 267
6 SASI_Mm01_00194113 predicted 476
7 SASI_Mm01_00194114 predicted 346
8 SASI_Mm01_00194115 predicted 306
9 SASI_Mm02_00323118 predicted 209
10 SASI_Mm01_00194117 predicted 282
11 SASI_Mm01_00194116 predicted 430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003480
VALIDATED
MFAP5 MISSION shRNA Bacterial Glycerol Stock
microfibrillar associated protein 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003480.2-322s1c1
Sequence:CCGGGCGACTCCAGAAACATTCACACTCGAGTGTGAATGTTTCTGGAGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003480.2-367s1c1
Sequence:CCGGCCCGCTACAGATGAAACAGTTCTCGAGAACTGTTTCATCTGTAGCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003480.2-2704s1c1
Sequence:CCGGGCACAGAGTTTCCAAGATTAACTCGAGTTAATCTTGGAAACTCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003480.2-343s1c1
Sequence:CCGGGAAGATCCTAATCTGGTGAATCTCGAGATTCACCAGATTAGGATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003480.2-346s1c1
Sequence:CCGGGATCCTAATCTGGTGAATGATCTCGAGATCATTCACCAGATTAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003480.2-532s1c1
Sequence:CCGGCAGTTATGCTTCACCAGTTTACTCGAGTAAACTGGTGAAGCATAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003480.2-592s1c1
Sequence:CCGGCTTGTCTGTAAGGAACACGAACTCGAGTTCGTGTTCCTTACAGACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003480.2-240s1c1
Sequence:CCGGGCTGTTTCTTGCTGCATTCATCTCGAGATGAATGCAGCAAGAAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003480.2-2681s1c1
Sequence:CCGGGCCACTTTAGAGAAACCTCATCTCGAGATGAGGTTTCTCTAAAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003480.2-543s1c1
Sequence:CCGGCACCAGTTTACGACGTATGTACTCGAGTACATACGTCGTAAACTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003480.2-540s1c1
Sequence:CCGGCTTCACCAGTTTACGACGTATCTCGAGATACGTCGTAAACTGGTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003480
VALIDATED
MFAP5 MISSION shRNA shRNA Plasmid DNA
microfibrillar associated protein 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003480.2-322s1c1
Sequence:CCGGGCGACTCCAGAAACATTCACACTCGAGTGTGAATGTTTCTGGAGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003480.2-367s1c1
Sequence:CCGGCCCGCTACAGATGAAACAGTTCTCGAGAACTGTTTCATCTGTAGCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003480.2-2704s1c1
Sequence:CCGGGCACAGAGTTTCCAAGATTAACTCGAGTTAATCTTGGAAACTCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003480.2-343s1c1
Sequence:CCGGGAAGATCCTAATCTGGTGAATCTCGAGATTCACCAGATTAGGATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003480.2-346s1c1
Sequence:CCGGGATCCTAATCTGGTGAATGATCTCGAGATCATTCACCAGATTAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003480.2-532s1c1
Sequence:CCGGCAGTTATGCTTCACCAGTTTACTCGAGTAAACTGGTGAAGCATAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003480.2-592s1c1
Sequence:CCGGCTTGTCTGTAAGGAACACGAACTCGAGTTCGTGTTCCTTACAGACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003480.2-240s1c1
Sequence:CCGGGCTGTTTCTTGCTGCATTCATCTCGAGATGAATGCAGCAAGAAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003480.2-2681s1c1
Sequence:CCGGGCCACTTTAGAGAAACCTCATCTCGAGATGAGGTTTCTCTAAAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003480.2-543s1c1
Sequence:CCGGCACCAGTTTACGACGTATGTACTCGAGTACATACGTCGTAAACTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003480.2-540s1c1
Sequence:CCGGCTTCACCAGTTTACGACGTATCTCGAGATACGTCGTAAACTGGTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003480
VALIDATED
MFAP5 MISSION shRNA Lentiviral Transduction Particles
microfibrillar associated protein 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003480.2-322s1c1
Sequence:CCGGGCGACTCCAGAAACATTCACACTCGAGTGTGAATGTTTCTGGAGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003480.2-367s1c1
Sequence:CCGGCCCGCTACAGATGAAACAGTTCTCGAGAACTGTTTCATCTGTAGCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003480.2-2704s1c1
Sequence:CCGGGCACAGAGTTTCCAAGATTAACTCGAGTTAATCTTGGAAACTCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003480.2-343s1c1
Sequence:CCGGGAAGATCCTAATCTGGTGAATCTCGAGATTCACCAGATTAGGATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003480.2-346s1c1
Sequence:CCGGGATCCTAATCTGGTGAATGATCTCGAGATCATTCACCAGATTAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003480.2-532s1c1
Sequence:CCGGCAGTTATGCTTCACCAGTTTACTCGAGTAAACTGGTGAAGCATAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003480.2-592s1c1
Sequence:CCGGCTTGTCTGTAAGGAACACGAACTCGAGTTCGTGTTCCTTACAGACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003480.2-240s1c1
Sequence:CCGGGCTGTTTCTTGCTGCATTCATCTCGAGATGAATGCAGCAAGAAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003480.2-2681s1c1
Sequence:CCGGGCCACTTTAGAGAAACCTCATCTCGAGATGAGGTTTCTCTAAAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003480.2-543s1c1
Sequence:CCGGCACCAGTTTACGACGTATGTACTCGAGTACATACGTCGTAAACTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003480.2-540s1c1
Sequence:CCGGCTTCACCAGTTTACGACGTATCTCGAGATACGTCGTAAACTGGTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015776
VALIDATED
MFAP5 MISSION shRNA Bacterial Glycerol Stock
microfibrillar associated protein 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015776.1-372s1c1
Sequence:CCGGCGGCGCATGTACATCATCAATCTCGAGATTGATGATGTACATGCGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192877    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015776.1-805s1c1
Sequence:CCGGGCCACTTGACTTAGATACATTCTCGAGAATGTATCTAAGTCAAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015776.1-285s1c1
Sequence:CCGGCGGGATGAGAAGTTTGCTTGTCTCGAGACAAGCAAACTTCTCATCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015776.1-151s1c1
Sequence:CCGGGAGATGATGTGCCTGAGACATCTCGAGATGTCTCAGGCACATCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015776.1-944s1c1
Sequence:CCGGGCCTCGTATATAATAGTCAATCTCGAGATTGACTATTATATACGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015776
VALIDATED
MFAP5 MISSION shRNA shRNA Plasmid DNA
microfibrillar associated protein 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015776.1-372s1c1
Sequence:CCGGCGGCGCATGTACATCATCAATCTCGAGATTGATGATGTACATGCGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192877    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015776.1-805s1c1
Sequence:CCGGGCCACTTGACTTAGATACATTCTCGAGAATGTATCTAAGTCAAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015776.1-285s1c1
Sequence:CCGGCGGGATGAGAAGTTTGCTTGTCTCGAGACAAGCAAACTTCTCATCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015776.1-151s1c1
Sequence:CCGGGAGATGATGTGCCTGAGACATCTCGAGATGTCTCAGGCACATCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015776.1-944s1c1
Sequence:CCGGGCCTCGTATATAATAGTCAATCTCGAGATTGACTATTATATACGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015776
VALIDATED
MFAP5 MISSION shRNA Lentiviral Transduction Particles
microfibrillar associated protein 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015776.1-372s1c1
Sequence:CCGGCGGCGCATGTACATCATCAATCTCGAGATTGATGATGTACATGCGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192877    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015776.1-805s1c1
Sequence:CCGGGCCACTTGACTTAGATACATTCTCGAGAATGTATCTAAGTCAAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015776.1-285s1c1
Sequence:CCGGCGGGATGAGAAGTTTGCTTGTCTCGAGACAAGCAAACTTCTCATCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015776.1-151s1c1
Sequence:CCGGGAGATGATGTGCCTGAGACATCTCGAGATGTCTCAGGCACATCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015776.1-944s1c1
Sequence:CCGGGCCTCGTATATAATAGTCAATCTCGAGATTGACTATTATATACGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)