EMAIL THIS PAGE TO A FRIEND

MFF

mitochondrial fission factor

134 Gene Product Result for
Synonyms: C2orf33 GL004
UniProtKB ID: Q9GZY8, Q567U1, Q658R6, Q9BVZ1, Q9H690, Q9NRG8
Gene ID:
Human(56947) Summary: This is a nuclear gene encoding a protein that functions in mitochondrial and peroxisomal fission. The encoded protein recruits dynamin-1-like protein (DNM1L) to mitochondria. There are multiple pseudogenes for this gene on chromosomes 1, 5, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Mouse(75734) mitochondrial fission factor
Rat(301563) mitochondrial fission factor
sheep(101103045) mitochondrial fission factor
naked mole-rat(101711030) mitochondrial fission factor
Domestic Rabbit(100328889) mitochondrial fission factor
domestic guinea pig(100716186) mitochondrial fission factor
Zebrafish(393508) mitochondrial fission factor
dog(477395) mitochondrial fission factor
Horse(100056853) mitochondrial fission factor
cow(506291) mitochondrial fission factor
domestic cat(101087770) mitochondrial fission factor
chicken(424796) mitochondrial fission factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029409 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029409 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029409 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020194 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020194 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020194 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114851 MISSION® esiRNA esiRNA human MFF (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020194 Rosetta Predictions human pricing
NM_001039015 Rosetta Predictions rat pricing
NM_029409 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158246 predicted 1045
2 SASI_Hs02_00353117 predicted 1044
3 SASI_Hs01_00158251 predicted 691
4 SASI_Hs02_00353118 predicted 610
5 SASI_Hs02_00353119 predicted 344
6 SASI_Hs01_00158254 predicted 1097
7 SASI_Hs02_00353120 predicted 770
8 SASI_Hs02_00353121 predicted 350
9 SASI_Hs02_00353122 predicted 834
10 SASI_Hs02_00353123 predicted 1175
11 SASI_Hs01_00158247 predicted 493
12 SASI_Hs01_00158248 predicted 1123
13 SASI_Hs01_00158249 predicted 1171
14 SASI_Hs01_00158250 predicted 629
15 SASI_Hs01_00158252 predicted 1230
16 SASI_Hs01_00158253 predicted 1351
17 SASI_Hs01_00158255 predicted 1204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039015 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039263 predicted 848
2 SASI_Rn01_00039264 predicted 309
3 SASI_Rn01_00039265 predicted 353
4 SASI_Rn01_00039266 predicted 696
5 SASI_Rn01_00039267 predicted 543
6 SASI_Rn01_00039268 predicted 583
7 SASI_Rn01_00039269 predicted 657
8 SASI_Rn01_00039270 predicted 436
9 SASI_Rn01_00039271 predicted 659
10 SASI_Rn02_00204745 predicted 679
11 SASI_Rn01_00039272 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049362 predicted 946
2 SASI_Mm01_00049363 predicted 723
3 SASI_Mm01_00049365 predicted 352
4 SASI_Mm01_00049366 predicted 536
5 SASI_Mm01_00049367 predicted 1114
6 SASI_Mm01_00049368 predicted 429
7 SASI_Mm01_00049369 predicted 1096
8 SASI_Mm01_00049370 predicted 992
9 SASI_Mm02_00335305 predicted 997
10 SASI_Mm02_00335306 predicted 939
11 SASI_Mm01_00049364 predicted 1013
12 SASI_Mm01_00049371 predicted 1254
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029409
VALIDATED
MFF MISSION shRNA Bacterial Glycerol Stock
mitochondrial fission factor
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029409.2-358s21c1
Sequence:CCGGCGAAGGTATTAGTCAGCGAATCTCGAGATTCGCTGACTAATACCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029409.2-1376s21c1
Sequence:CCGGGTTGTGCAGTGGCACCTATACCTCGAGGTATAGGTGCCACTGCACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029409.2-484s1c1
Sequence:CCGGGATCGTGGTTACAGGAAATAACTCGAGTTATTTCCTGTAACCACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029409.2-1044s1c1
Sequence:CCGGCTTCATTAAGACGTCAGATAACTCGAGTTATCTGACGTCTTAATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029409.2-1044s21c1
Sequence:CCGGCTTCATTAAGACGTCAGATAACTCGAGTTATCTGACGTCTTAATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029409.2-802s1c1
Sequence:CCGGGCTACCTGAAGATGGAGCTAACTCGAGTTAGCTCCATCTTCAGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029409.2-1135s1c1
Sequence:CCGGGTATTCAATCACTGTAGCGTTCTCGAGAACGCTACAGTGATTGAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029409.2-358s1c1
Sequence:CCGGCGAAGGTATTAGTCAGCGAATCTCGAGATTCGCTGACTAATACCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029409.2-693s1c1
Sequence:CCGGGAGAGCGTTCTATGAGTGAAACTCGAGTTTCACTCATAGAACGCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029409.2-966s21c1
Sequence:CCGGACAACGTCAGGTATGGCATTTCTCGAGAAATGCCATACCTGACGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029409.2-484s21c1
Sequence:CCGGGATCGTGGTTACAGGAAATAACTCGAGTTATTTCCTGTAACCACGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029409
VALIDATED
MFF MISSION shRNA shRNA Plasmid DNA
mitochondrial fission factor
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029409.2-358s21c1
Sequence:CCGGCGAAGGTATTAGTCAGCGAATCTCGAGATTCGCTGACTAATACCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029409.2-1376s21c1
Sequence:CCGGGTTGTGCAGTGGCACCTATACCTCGAGGTATAGGTGCCACTGCACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029409.2-484s1c1
Sequence:CCGGGATCGTGGTTACAGGAAATAACTCGAGTTATTTCCTGTAACCACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029409.2-1044s1c1
Sequence:CCGGCTTCATTAAGACGTCAGATAACTCGAGTTATCTGACGTCTTAATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029409.2-1044s21c1
Sequence:CCGGCTTCATTAAGACGTCAGATAACTCGAGTTATCTGACGTCTTAATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029409.2-802s1c1
Sequence:CCGGGCTACCTGAAGATGGAGCTAACTCGAGTTAGCTCCATCTTCAGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029409.2-1135s1c1
Sequence:CCGGGTATTCAATCACTGTAGCGTTCTCGAGAACGCTACAGTGATTGAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029409.2-358s1c1
Sequence:CCGGCGAAGGTATTAGTCAGCGAATCTCGAGATTCGCTGACTAATACCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029409.2-693s1c1
Sequence:CCGGGAGAGCGTTCTATGAGTGAAACTCGAGTTTCACTCATAGAACGCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029409.2-966s21c1
Sequence:CCGGACAACGTCAGGTATGGCATTTCTCGAGAAATGCCATACCTGACGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029409.2-484s21c1
Sequence:CCGGGATCGTGGTTACAGGAAATAACTCGAGTTATTTCCTGTAACCACGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029409
VALIDATED
MFF MISSION shRNA Lentiviral Transduction Particles
mitochondrial fission factor
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029409.2-358s21c1
Sequence:CCGGCGAAGGTATTAGTCAGCGAATCTCGAGATTCGCTGACTAATACCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029409.2-1376s21c1
Sequence:CCGGGTTGTGCAGTGGCACCTATACCTCGAGGTATAGGTGCCACTGCACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029409.2-484s1c1
Sequence:CCGGGATCGTGGTTACAGGAAATAACTCGAGTTATTTCCTGTAACCACGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029409.2-1044s1c1
Sequence:CCGGCTTCATTAAGACGTCAGATAACTCGAGTTATCTGACGTCTTAATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029409.2-1044s21c1
Sequence:CCGGCTTCATTAAGACGTCAGATAACTCGAGTTATCTGACGTCTTAATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029409.2-802s1c1
Sequence:CCGGGCTACCTGAAGATGGAGCTAACTCGAGTTAGCTCCATCTTCAGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029409.2-1135s1c1
Sequence:CCGGGTATTCAATCACTGTAGCGTTCTCGAGAACGCTACAGTGATTGAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029409.2-358s1c1
Sequence:CCGGCGAAGGTATTAGTCAGCGAATCTCGAGATTCGCTGACTAATACCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029409.2-693s1c1
Sequence:CCGGGAGAGCGTTCTATGAGTGAAACTCGAGTTTCACTCATAGAACGCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029409.2-966s21c1
Sequence:CCGGACAACGTCAGGTATGGCATTTCTCGAGAAATGCCATACCTGACGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029409.2-484s21c1
Sequence:CCGGGATCGTGGTTACAGGAAATAACTCGAGTTATTTCCTGTAACCACGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020194
MFF MISSION shRNA Bacterial Glycerol Stock
mitochondrial fission factor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020194.4-477s21c1
Sequence:CCGGCCAAATGCTAGTGTGATAATGCTCGAGCATTATCACACTAGCATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020194.4-1728s1c1
Sequence:CCGGGCATCGACACTTCAACATTAACTCGAGTTAATGTTGAAGTGTCGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020194.4-365s21c1
Sequence:CCGGTCAGTACGAAATGGAATATACCTCGAGGTATATTCCATTTCGTACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020194.4-1073s1c1
Sequence:CCGGCGTCAGGTATGGCATTTCAAACTCGAGTTTGAAATGCCATACCTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020194.4-1047s1c1
Sequence:CCGGGCCACTTCTAATCCTCATCATCTCGAGATGATGAGGATTAGAAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020194.4-1783s21c1
Sequence:CCGGGAAACTCGAACCACCTAATATCTCGAGATATTAGGTGGTTCGAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020194.4-1203s21c1
Sequence:CCGGGAGAACAAAGAACGTGCTAAACTCGAGTTTAGCACGTTCTTTGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020194.4-1252s21c1
Sequence:CCGGTAGCTTTCTGGCTGCTTAATACTCGAGTATTAAGCAGCCAGAAAGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020194
MFF MISSION shRNA shRNA Plasmid DNA
mitochondrial fission factor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020194.4-477s21c1
Sequence:CCGGCCAAATGCTAGTGTGATAATGCTCGAGCATTATCACACTAGCATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020194.4-1728s1c1
Sequence:CCGGGCATCGACACTTCAACATTAACTCGAGTTAATGTTGAAGTGTCGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020194.4-365s21c1
Sequence:CCGGTCAGTACGAAATGGAATATACCTCGAGGTATATTCCATTTCGTACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020194.4-1073s1c1
Sequence:CCGGCGTCAGGTATGGCATTTCAAACTCGAGTTTGAAATGCCATACCTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020194.4-1047s1c1
Sequence:CCGGGCCACTTCTAATCCTCATCATCTCGAGATGATGAGGATTAGAAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020194.4-1783s21c1
Sequence:CCGGGAAACTCGAACCACCTAATATCTCGAGATATTAGGTGGTTCGAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020194.4-1203s21c1
Sequence:CCGGGAGAACAAAGAACGTGCTAAACTCGAGTTTAGCACGTTCTTTGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020194.4-1252s21c1
Sequence:CCGGTAGCTTTCTGGCTGCTTAATACTCGAGTATTAAGCAGCCAGAAAGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020194
MFF MISSION shRNA Lentiviral Transduction Particles
mitochondrial fission factor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020194.4-477s21c1
Sequence:CCGGCCAAATGCTAGTGTGATAATGCTCGAGCATTATCACACTAGCATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020194.4-1728s1c1
Sequence:CCGGGCATCGACACTTCAACATTAACTCGAGTTAATGTTGAAGTGTCGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020194.4-365s21c1
Sequence:CCGGTCAGTACGAAATGGAATATACCTCGAGGTATATTCCATTTCGTACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020194.4-1073s1c1
Sequence:CCGGCGTCAGGTATGGCATTTCAAACTCGAGTTTGAAATGCCATACCTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020194.4-1047s1c1
Sequence:CCGGGCCACTTCTAATCCTCATCATCTCGAGATGATGAGGATTAGAAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020194.4-1783s21c1
Sequence:CCGGGAAACTCGAACCACCTAATATCTCGAGATATTAGGTGGTTCGAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020194.4-1203s21c1
Sequence:CCGGGAGAACAAAGAACGTGCTAAACTCGAGTTTAGCACGTTCTTTGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020194.4-1252s21c1
Sequence:CCGGTAGCTTTCTGGCTGCTTAATACTCGAGTATTAAGCAGCCAGAAAGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)