EMAIL THIS PAGE TO A FRIEND

MFGE8

milk fat globule-EGF factor 8 protein

92 Gene Product Result for
Synonyms: BA46 EDIL1 HMFG HsT19888 MFG-E8 MFGM OAcGD3S SED1 SPAG10 hP47
UniProtKB ID: Q08431, B2R6M7, Q53FU9, Q7Z3D2, Q9BTL9
Gene ID:
Mouse(17304) milk fat globule-EGF factor 8 protein
Rat(25277) milk fat globule-EGF factor 8 protein
chicken(415494) milk fat globule-EGF factor 8 protein
dog(488730) milk fat globule-EGF factor 8 protein
domestic cat(101091372) milk fat globule-EGF factor 8 protein
cow(281913) milk fat globule-EGF factor 8 protein
Horse(100033943) milk fat globule-EGF factor 8 protein
domestic guinea pig(100729745) milk fat globule-EGF factor 8 protein
naked mole-rat(101697626) milk fat globule-EGF factor 8 protein
Goat(100861394) milk fat globule-EGF factor 8 protein
sheep(100820737) milk fat globule-EGF factor 8 protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005928 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005928 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005928 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008594 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008594 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008594 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114614 Rosetta Predictions human pricing
NM_005928 Rosetta Predictions human pricing
NM_001040186 Rosetta Predictions rat pricing
NM_012811 Rosetta Predictions rat pricing
NM_001045489 Rosetta Predictions mouse pricing
NM_008594 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326654 predicted 612
2 SASI_Hs02_00326655 predicted 755
3 SASI_Hs02_00326656 predicted 611
4 SASI_Hs02_00326657 predicted 595
5 SASI_Hs02_00326658 predicted 381
6 SASI_Hs02_00326659 predicted 585
7 SASI_Hs02_00326660 predicted 346
8 SASI_Hs02_00326661 predicted 579
9 SASI_Hs02_00326662 predicted 293
10 SASI_Hs02_00326663 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340574 predicted 614
2 SASI_Hs02_00340575 predicted 753
3 SASI_Hs02_00340576 predicted 606
4 SASI_Hs02_00340577 predicted 593
5 SASI_Hs02_00340578 predicted 385
6 SASI_Hs01_00111148 predicted 591
7 SASI_Hs01_00111149 predicted 345
8 SASI_Hs01_00111150 predicted 573
9 SASI_Hs02_00340579 predicted 293
10 SASI_Hs02_00340580 predicted 717
11 SASI_Hs01_00111151 predicted 246
12 SASI_Hs01_00111152 predicted 737
13 SASI_Hs01_00111153 predicted 258
14 SASI_Hs01_00111154 predicted 1045
15 SASI_Hs01_00111155 predicted 596
16 SASI_Hs01_00111156 predicted 726
17 SASI_Hs01_00111157 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061312 predicted 1308
2 SASI_Rn01_00061313 predicted 1452
3 SASI_Rn01_00061314 predicted 880
4 SASI_Rn01_00061315 predicted 1519
5 SASI_Rn01_00061316 predicted 1361
6 SASI_Rn01_00061317 predicted 1410
7 SASI_Rn01_00061318 predicted 1178
8 SASI_Rn01_00061319 predicted 778
9 SASI_Rn01_00061320 predicted 1484
10 SASI_Rn01_00061321 predicted 1319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012811 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070470 predicted 1135
2 SASI_Rn01_00070471 predicted 1291
3 SASI_Rn01_00070472 predicted 718
4 SASI_Rn01_00070473 predicted 1355
5 SASI_Rn01_00070474 predicted 1188
6 SASI_Rn01_00070475 predicted 1234
7 SASI_Rn01_00070476 predicted 1011
8 SASI_Rn01_00070477 predicted 607
9 SASI_Rn01_00070478 predicted 1319
10 SASI_Rn01_00070479 predicted 1148
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045489 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291504 predicted 1754
2 SASI_Mm02_00291505 predicted 1524
3 SASI_Mm02_00291506 predicted 1264
4 SASI_Mm02_00291507 predicted 1196
5 SASI_Mm02_00291508 predicted 1299
6 SASI_Mm02_00291509 predicted 1326
7 SASI_Mm02_00291510 predicted 1529
8 SASI_Mm02_00291511 predicted 1620
9 SASI_Mm02_00291512 predicted 1001
10 SASI_Mm02_00291513 predicted 1248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008594 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084635 predicted 1868
2 SASI_Mm01_00084637 predicted 1643
3 SASI_Mm01_00084638 predicted 1370
4 SASI_Mm02_00314239 predicted 1311
5 SASI_Mm01_00084639 predicted 1408
6 SASI_Mm01_00084640 predicted 1440
7 SASI_Mm02_00314240 predicted 1644
8 SASI_Mm01_00084641 predicted 1723
9 SASI_Mm01_00084642 predicted 1112
10 SASI_Mm01_00084643 predicted 1358
11 SASI_Mm01_00084636 predicted 853
12 SASI_Mm01_00084644 predicted 948
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005928
VALIDATED
MFGE8 MISSION shRNA Bacterial Glycerol Stock
milk fat globule-EGF factor 8 protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005928.2-1543s21c1
Sequence:CCGGTGGACAGGAAAGGGCAAAGTACTCGAGTACTTTGCCCTTTCCTGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005928.2-467s21c1
Sequence:CCGGACCCAGCAGCAATGACGATAACTCGAGTTATCGTCATTGCTGCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005928.2-620s21c1
Sequence:CCGGCGATTTCATCCATGATGTTAACTCGAGTTAACATCATGGATGAAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005928.2-714s21c1
Sequence:CCGGGAGGCTCAGTACGTGAGATTGCTCGAGCAATCTCACGTACTGAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005928.2-215s21c1
Sequence:CCGGCGGTGGTTTATGCGAGGAGATCTCGAGATCTCCTCGCATAAACCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005928.2-1634s21c1
Sequence:CCGGCCTCTCTCACACATCACATTCCTCGAGGAATGTGATGTGTGAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005928.1-248s1c1
Sequence:CCGGGCAACCACTGTGAGACGAAATCTCGAGATTTCGTCTCACAGTGGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005928.1-545s1c1
Sequence:CCGGACAGCCTTAATGGACACGAATCTCGAGATTCGTGTCCATTAAGGCTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005928.1-162s1c1
Sequence:CCGGCGGTGGTTTATGCGAGGAGATCTCGAGATCTCCTCGCATAAACCACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005928.1-1026s1c1
Sequence:CCGGCTACAGTAATGACAGTGCGAACTCGAGTTCGCACTGTCATTACTGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005928.1-1114s1c1
Sequence:CCGGTCCCACAAGAAGAACTTGTTTCTCGAGAAACAAGTTCTTCTTGTGGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005928
VALIDATED
MFGE8 MISSION shRNA shRNA Plasmid DNA
milk fat globule-EGF factor 8 protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005928.2-1543s21c1
Sequence:CCGGTGGACAGGAAAGGGCAAAGTACTCGAGTACTTTGCCCTTTCCTGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005928.2-467s21c1
Sequence:CCGGACCCAGCAGCAATGACGATAACTCGAGTTATCGTCATTGCTGCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005928.2-620s21c1
Sequence:CCGGCGATTTCATCCATGATGTTAACTCGAGTTAACATCATGGATGAAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005928.2-714s21c1
Sequence:CCGGGAGGCTCAGTACGTGAGATTGCTCGAGCAATCTCACGTACTGAGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005928.2-215s21c1
Sequence:CCGGCGGTGGTTTATGCGAGGAGATCTCGAGATCTCCTCGCATAAACCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005928.2-1634s21c1
Sequence:CCGGCCTCTCTCACACATCACATTCCTCGAGGAATGTGATGTGTGAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005928.1-248s1c1
Sequence:CCGGGCAACCACTGTGAGACGAAATCTCGAGATTTCGTCTCACAGTGGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005928.1-545s1c1
Sequence:CCGGACAGCCTTAATGGACACGAATCTCGAGATTCGTGTCCATTAAGGCTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005928.1-162s1c1
Sequence:CCGGCGGTGGTTTATGCGAGGAGATCTCGAGATCTCCTCGCATAAACCACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005928.1-1026s1c1
Sequence:CCGGCTACAGTAATGACAGTGCGAACTCGAGTTCGCACTGTCATTACTGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005928.1-1114s1c1
Sequence:CCGGTCCCACAAGAAGAACTTGTTTCTCGAGAAACAAGTTCTTCTTGTGGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005928
VALIDATED
MFGE8 MISSION shRNA Lentiviral Transduction Particles
milk fat globule-EGF factor 8 protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005928.2-1543s21c1
Sequence:CCGGTGGACAGGAAAGGGCAAAGTACTCGAGTACTTTGCCCTTTCCTGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005928.2-467s21c1
Sequence:CCGGACCCAGCAGCAATGACGATAACTCGAGTTATCGTCATTGCTGCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005928.2-620s21c1
Sequence:CCGGCGATTTCATCCATGATGTTAACTCGAGTTAACATCATGGATGAAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005928.2-714s21c1
Sequence:CCGGGAGGCTCAGTACGTGAGATTGCTCGAGCAATCTCACGTACTGAGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005928.2-215s21c1
Sequence:CCGGCGGTGGTTTATGCGAGGAGATCTCGAGATCTCCTCGCATAAACCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005928.2-1634s21c1
Sequence:CCGGCCTCTCTCACACATCACATTCCTCGAGGAATGTGATGTGTGAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005928.1-248s1c1
Sequence:CCGGGCAACCACTGTGAGACGAAATCTCGAGATTTCGTCTCACAGTGGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005928.1-545s1c1
Sequence:CCGGACAGCCTTAATGGACACGAATCTCGAGATTCGTGTCCATTAAGGCTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005928.1-162s1c1
Sequence:CCGGCGGTGGTTTATGCGAGGAGATCTCGAGATCTCCTCGCATAAACCACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005928.1-1026s1c1
Sequence:CCGGCTACAGTAATGACAGTGCGAACTCGAGTTCGCACTGTCATTACTGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005928.1-1114s1c1
Sequence:CCGGTCCCACAAGAAGAACTTGTTTCTCGAGAAACAAGTTCTTCTTGTGGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008594
VALIDATED
MFGE8 MISSION shRNA Bacterial Glycerol Stock
milk fat globule-EGF factor 8 protein
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008594.2-1253s21c1
Sequence:CCGGACTTTGGCCACATCCAGTATGCTCGAGCATACTGGATGTGGCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008594.2-923s21c1
Sequence:CCGGCTCTGGAGGCACAGTACATAACTCGAGTTATGTACTGTGCCTCCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008594.2-1136s21c1
Sequence:CCGGATAATCAGGGCAAGATCAATGCTCGAGCATTGATCTTGCCCTGATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008594.2-566s21c1
Sequence:CCGGCCATTGCTGATTCACAGATTTCTCGAGAAATCTGTGAATCAGCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008594.2-1586s21c1
Sequence:CCGGCTTGGCCTTCCCTTCTGATTGCTCGAGCAATCAGAAGGGAAGGCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008594.1-259s1c1
Sequence:CCGGCCTTGCTACAATGATGCCAAACTCGAGTTTGGCATCATTGTAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008594.2-1727s21c1
Sequence:CCGGTGGACAGGTCTGAGATGAATACTCGAGTATTCATCTCAGACCTGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008594.2-432s21c1
Sequence:CCGGCTACAACCTGGATGGAGAATACTCGAGTATTCTCCATCCAGGTTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008594.1-1083s1c1
Sequence:CCGGGCTGGATAATCAGGGCAAGATCTCGAGATCTTGCCCTGATTATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008594.1-1821s1c1
Sequence:CCGGCACCACACATTCCTCCATGTTCTCGAGAACATGGAGGAATGTGTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008594.1-457s1c1
Sequence:CCGGCCCGATCTTTCCAACAACCTACTCGAGTAGGTTGTTGGAAAGATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008594.1-774s1c1
Sequence:CCGGCGGACGCAAGTTTGAGTTCATCTCGAGATGAACTCAAACTTGCGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008594
VALIDATED
MFGE8 MISSION shRNA shRNA Plasmid DNA
milk fat globule-EGF factor 8 protein
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008594.2-1253s21c1
Sequence:CCGGACTTTGGCCACATCCAGTATGCTCGAGCATACTGGATGTGGCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008594.2-923s21c1
Sequence:CCGGCTCTGGAGGCACAGTACATAACTCGAGTTATGTACTGTGCCTCCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008594.2-1136s21c1
Sequence:CCGGATAATCAGGGCAAGATCAATGCTCGAGCATTGATCTTGCCCTGATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008594.2-566s21c1
Sequence:CCGGCCATTGCTGATTCACAGATTTCTCGAGAAATCTGTGAATCAGCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008594.2-1586s21c1
Sequence:CCGGCTTGGCCTTCCCTTCTGATTGCTCGAGCAATCAGAAGGGAAGGCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008594.1-259s1c1
Sequence:CCGGCCTTGCTACAATGATGCCAAACTCGAGTTTGGCATCATTGTAGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008594.2-1727s21c1
Sequence:CCGGTGGACAGGTCTGAGATGAATACTCGAGTATTCATCTCAGACCTGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008594.2-432s21c1
Sequence:CCGGCTACAACCTGGATGGAGAATACTCGAGTATTCTCCATCCAGGTTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008594.1-1083s1c1
Sequence:CCGGGCTGGATAATCAGGGCAAGATCTCGAGATCTTGCCCTGATTATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008594.1-1821s1c1
Sequence:CCGGCACCACACATTCCTCCATGTTCTCGAGAACATGGAGGAATGTGTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008594.1-457s1c1
Sequence:CCGGCCCGATCTTTCCAACAACCTACTCGAGTAGGTTGTTGGAAAGATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008594.1-774s1c1
Sequence:CCGGCGGACGCAAGTTTGAGTTCATCTCGAGATGAACTCAAACTTGCGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008594
VALIDATED
MFGE8 MISSION shRNA Lentiviral Transduction Particles
milk fat globule-EGF factor 8 protein
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008594.2-1253s21c1
Sequence:CCGGACTTTGGCCACATCCAGTATGCTCGAGCATACTGGATGTGGCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008594.2-923s21c1
Sequence:CCGGCTCTGGAGGCACAGTACATAACTCGAGTTATGTACTGTGCCTCCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008594.2-1136s21c1
Sequence:CCGGATAATCAGGGCAAGATCAATGCTCGAGCATTGATCTTGCCCTGATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008594.2-566s21c1
Sequence:CCGGCCATTGCTGATTCACAGATTTCTCGAGAAATCTGTGAATCAGCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008594.2-1586s21c1
Sequence:CCGGCTTGGCCTTCCCTTCTGATTGCTCGAGCAATCAGAAGGGAAGGCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008594.1-259s1c1
Sequence:CCGGCCTTGCTACAATGATGCCAAACTCGAGTTTGGCATCATTGTAGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008594.2-1727s21c1
Sequence:CCGGTGGACAGGTCTGAGATGAATACTCGAGTATTCATCTCAGACCTGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008594.2-432s21c1
Sequence:CCGGCTACAACCTGGATGGAGAATACTCGAGTATTCTCCATCCAGGTTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008594.1-1083s1c1
Sequence:CCGGGCTGGATAATCAGGGCAAGATCTCGAGATCTTGCCCTGATTATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008594.1-1821s1c1
Sequence:CCGGCACCACACATTCCTCCATGTTCTCGAGAACATGGAGGAATGTGTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008594.1-457s1c1
Sequence:CCGGCCCGATCTTTCCAACAACCTACTCGAGTAGGTTGTTGGAAAGATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008594.1-774s1c1
Sequence:CCGGCGGACGCAAGTTTGAGTTCATCTCGAGATGAACTCAAACTTGCGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)