EMAIL THIS PAGE TO A FRIEND

MFI2

antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5

66 Gene Product Result for
Synonyms: CD228 MAP97 MTF1
UniProtKB ID: P08582, Q9BQE2
Gene ID:
Human(4241) Summary: The protein encoded by this gene is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not yet been identified. This gene resides in the same region of chromosome 3 as members of the transferrin superfamily. Alternative splicing results in two transcript variants. [provided by RefSeq, Jul 2008]
Mouse(30060) antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
Rat(288038) antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
Zebrafish(565942) antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
domestic cat(101088948) antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
Horse(100060123) antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
cow(539803) antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
dog(488035) antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
chicken(396127) antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
domestic guinea pig(100721829) antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
naked mole-rat(101707389) antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
Domestic Rabbit(100008603) antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
sheep(101102773) antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005929 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005929 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005929 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013900 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013900 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013900 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005929 Rosetta Predictions human pricing
NM_033316 Rosetta Predictions human pricing
NM_001105872 Rosetta Predictions rat pricing
NM_013900 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340581 predicted 396
2 SASI_Hs01_00155789 predicted 475
3 SASI_Hs02_00340582 predicted 353
4 SASI_Hs02_00340583 predicted 208
5 SASI_Hs01_00155793 predicted 566
6 SASI_Hs01_00155794 predicted 566
7 SASI_Hs02_00340584 predicted 218
8 SASI_Hs01_00155795 predicted 526
9 SASI_Hs02_00340585 predicted 217
10 SASI_Hs02_00340586 predicted 588
11 SASI_Hs01_00155790 predicted 521
12 SASI_Hs01_00155791 predicted 415
13 SASI_Hs01_00155792 predicted 348
14 SASI_Hs01_00155796 predicted 527
15 SASI_Hs01_00155797 predicted 516
16 SASI_Hs01_00155798 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361164 predicted 397
2 SASI_Hs01_00135874 predicted 474
3 SASI_Hs02_00361165 predicted 351
4 SASI_Hs02_00361166 predicted 203
5 SASI_Hs01_00135878 predicted 564
6 SASI_Hs01_00135879 predicted 571
7 SASI_Hs02_00361167 predicted 215
8 SASI_Hs01_00135880 predicted 522
9 SASI_Hs02_00361168 predicted 219
10 SASI_Hs02_00361169 predicted 593
11 SASI_Hs01_00135875 predicted 529
12 SASI_Hs01_00135876 predicted 415
13 SASI_Hs01_00135877 predicted 350
14 SASI_Hs01_00135881 predicted 529
15 SASI_Hs01_00135882 predicted 514
16 SASI_Hs01_00135883 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105872 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213362 predicted 695
2 SASI_Rn02_00213363 predicted 2074
3 SASI_Rn02_00213364 predicted 597
4 SASI_Rn02_00213365 predicted 357
5 SASI_Rn02_00213366 predicted 2013
6 SASI_Rn02_00213367 predicted 1248
7 SASI_Rn02_00213368 predicted 1074
8 SASI_Rn02_00213369 predicted 2193
9 SASI_Rn02_00213370 predicted 1963
10 SASI_Rn02_00213371 predicted 1383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013900 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039628 predicted 597
2 SASI_Mm01_00039629 predicted 1274
3 SASI_Mm01_00039630 predicted 1070
4 SASI_Mm01_00039631 predicted 350
5 SASI_Mm01_00039632 predicted 1384
6 SASI_Mm01_00039633 predicted 1673
7 SASI_Mm01_00039634 predicted 1687
8 SASI_Mm01_00039636 predicted 731
9 SASI_Mm01_00039637 predicted 2049
10 SASI_Mm02_00322967 predicted 2193
11 SASI_Mm01_00039635 predicted 2016
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005929
VALIDATED
MFI2 MISSION shRNA Bacterial Glycerol Stock
antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-1116s21c1
Sequence:CCGGATCGCCACACAGACCTATGAGCTCGAGCTCATAGGTCTGTGTGGCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-1091s21c1
Sequence:CCGGAGACTCTACCTCGGAGCTTGTCTCGAGACAAGCTCCGAGGTAGAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-2011s21c1
Sequence:CCGGCCAACATCTTCACCGTGTATGCTCGAGCATACACGGTGAAGATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-1754s21c1
Sequence:CCGGCAACAGCCAGGAGCGGTATTACTCGAGTAATACCGCTCCTGGCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-791s21c1
Sequence:CCGGTGTGAAGCACAGCACGGTACTCTCGAGAGTACCGTGCTGTGCTTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005929.3-1796s1c1
Sequence:CCGGCAACCGTCTTTGACAACACAACTCGAGTTGTGTTGTCAAAGACGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005929.3-2025s1c1
Sequence:CCGGCCACAATAAGAACGGGTTCAACTCGAGTTGAACCCGTTCTTATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005929.3-424s1c1
Sequence:CCGGGTGACCATTGACACCCTGAAACTCGAGTTTCAGGGTGTCAATGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005929.3-552s1c1
Sequence:CCGGCAAAGCTGTCAGCGACTATTTCTCGAGAAATAGTCGCTGACAGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005929.3-165s1c1
Sequence:CCGGGCAGCACAAGTGCGGCAACATCTCGAGATGTTGCCGCACTTGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-398s21c1
Sequence:CCGGGGGCGAAGTGTACGATCAAGACTCGAGTCTTGATCGTACACTTCGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-2092s21c1
Sequence:CCGGTGTTCGACTCCTCCAACTATCCTCGAGGATAGTTGGAGGAGTCGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-1891s21c1
Sequence:CCGGAGCTCAGGTCAGAGGACTATGCTCGAGCATAGTCCTCTGACCTGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005929
VALIDATED
MFI2 MISSION shRNA shRNA Plasmid DNA
antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-1116s21c1
Sequence:CCGGATCGCCACACAGACCTATGAGCTCGAGCTCATAGGTCTGTGTGGCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-1091s21c1
Sequence:CCGGAGACTCTACCTCGGAGCTTGTCTCGAGACAAGCTCCGAGGTAGAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-2011s21c1
Sequence:CCGGCCAACATCTTCACCGTGTATGCTCGAGCATACACGGTGAAGATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-1754s21c1
Sequence:CCGGCAACAGCCAGGAGCGGTATTACTCGAGTAATACCGCTCCTGGCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-791s21c1
Sequence:CCGGTGTGAAGCACAGCACGGTACTCTCGAGAGTACCGTGCTGTGCTTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005929.3-1796s1c1
Sequence:CCGGCAACCGTCTTTGACAACACAACTCGAGTTGTGTTGTCAAAGACGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005929.3-2025s1c1
Sequence:CCGGCCACAATAAGAACGGGTTCAACTCGAGTTGAACCCGTTCTTATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005929.3-424s1c1
Sequence:CCGGGTGACCATTGACACCCTGAAACTCGAGTTTCAGGGTGTCAATGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005929.3-552s1c1
Sequence:CCGGCAAAGCTGTCAGCGACTATTTCTCGAGAAATAGTCGCTGACAGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005929.3-165s1c1
Sequence:CCGGGCAGCACAAGTGCGGCAACATCTCGAGATGTTGCCGCACTTGTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-398s21c1
Sequence:CCGGGGGCGAAGTGTACGATCAAGACTCGAGTCTTGATCGTACACTTCGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-2092s21c1
Sequence:CCGGTGTTCGACTCCTCCAACTATCCTCGAGGATAGTTGGAGGAGTCGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-1891s21c1
Sequence:CCGGAGCTCAGGTCAGAGGACTATGCTCGAGCATAGTCCTCTGACCTGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005929
VALIDATED
MFI2 MISSION shRNA Lentiviral Transduction Particles
antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-1116s21c1
Sequence:CCGGATCGCCACACAGACCTATGAGCTCGAGCTCATAGGTCTGTGTGGCGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-1091s21c1
Sequence:CCGGAGACTCTACCTCGGAGCTTGTCTCGAGACAAGCTCCGAGGTAGAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-2011s21c1
Sequence:CCGGCCAACATCTTCACCGTGTATGCTCGAGCATACACGGTGAAGATGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-1754s21c1
Sequence:CCGGCAACAGCCAGGAGCGGTATTACTCGAGTAATACCGCTCCTGGCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-791s21c1
Sequence:CCGGTGTGAAGCACAGCACGGTACTCTCGAGAGTACCGTGCTGTGCTTCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005929.3-1796s1c1
Sequence:CCGGCAACCGTCTTTGACAACACAACTCGAGTTGTGTTGTCAAAGACGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005929.3-2025s1c1
Sequence:CCGGCCACAATAAGAACGGGTTCAACTCGAGTTGAACCCGTTCTTATTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005929.3-424s1c1
Sequence:CCGGGTGACCATTGACACCCTGAAACTCGAGTTTCAGGGTGTCAATGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005929.3-552s1c1
Sequence:CCGGCAAAGCTGTCAGCGACTATTTCTCGAGAAATAGTCGCTGACAGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005929.3-165s1c1
Sequence:CCGGGCAGCACAAGTGCGGCAACATCTCGAGATGTTGCCGCACTTGTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-398s21c1
Sequence:CCGGGGGCGAAGTGTACGATCAAGACTCGAGTCTTGATCGTACACTTCGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-2092s21c1
Sequence:CCGGTGTTCGACTCCTCCAACTATCCTCGAGGATAGTTGGAGGAGTCGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005929.4-1891s21c1
Sequence:CCGGAGCTCAGGTCAGAGGACTATGCTCGAGCATAGTCCTCTGACCTGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013900
MFI2 MISSION shRNA Bacterial Glycerol Stock
antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013900.1-1674s1c1
Sequence:CCGGGCCTGTCAACAACCCTAAGAACTCGAGTTCTTAGGGTTGTTGACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013900.1-726s1c1
Sequence:CCGGCCTAGAGAGATACTACGACTACTCGAGTAGTCGTAGTATCTCTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013900.1-2070s1c1
Sequence:CCGGCGACCATAACAAGAACGGTTTCTCGAGAAACCGTTCTTGTTATGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013900.1-1074s1c1
Sequence:CCGGCCAGAAGAACTTGCTGTTCAACTCGAGTTGAACAGCAAGTTCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013900.1-406s1c1
Sequence:CCGGGAAGTCTATGACCAAGACATTCTCGAGAATGTCTTGGTCATAGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013900
MFI2 MISSION shRNA shRNA Plasmid DNA
antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013900.1-1674s1c1
Sequence:CCGGGCCTGTCAACAACCCTAAGAACTCGAGTTCTTAGGGTTGTTGACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013900.1-726s1c1
Sequence:CCGGCCTAGAGAGATACTACGACTACTCGAGTAGTCGTAGTATCTCTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013900.1-2070s1c1
Sequence:CCGGCGACCATAACAAGAACGGTTTCTCGAGAAACCGTTCTTGTTATGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013900.1-1074s1c1
Sequence:CCGGCCAGAAGAACTTGCTGTTCAACTCGAGTTGAACAGCAAGTTCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013900.1-406s1c1
Sequence:CCGGGAAGTCTATGACCAAGACATTCTCGAGAATGTCTTGGTCATAGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013900
MFI2 MISSION shRNA Lentiviral Transduction Particles
antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013900.1-1674s1c1
Sequence:CCGGGCCTGTCAACAACCCTAAGAACTCGAGTTCTTAGGGTTGTTGACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013900.1-726s1c1
Sequence:CCGGCCTAGAGAGATACTACGACTACTCGAGTAGTCGTAGTATCTCTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013900.1-2070s1c1
Sequence:CCGGCGACCATAACAAGAACGGTTTCTCGAGAAACCGTTCTTGTTATGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013900.1-1074s1c1
Sequence:CCGGCCAGAAGAACTTGCTGTTCAACTCGAGTTGAACAGCAAGTTCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013900.1-406s1c1
Sequence:CCGGGAAGTCTATGACCAAGACATTCTCGAGAATGTCTTGGTCATAGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)