EMAIL THIS PAGE TO A FRIEND

MFN1

mitofusin 1

59 Gene Product Result for
Synonyms: hfzo1 hfzo2
Gene ID:
Human(55669) Summary: The protein encoded by this gene is a mediator of mitochondrial fusion. This protein and mitofusin 2 are homologs of the Drosophila protein fuzzy onion (Fzo). They are mitochondrial membrane proteins that interact with each other to facilitate mitochondrial targeting. [provided by RefSeq, Jul 2008]
Mouse(67414) mitofusin 1
Rat(192647) mitofusin 1
chicken(424973) mitofusin 1
cow(515180) mitofusin 1
dog(488086) mitofusin 1
sheep(101109233) mitofusin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024200 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024200 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024200 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033540 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033540 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033540 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017927 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017927 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017927 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033540 Rosetta Predictions human pricing
NM_138976 Rosetta Predictions rat pricing
NM_024200 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057999 predicted 631
2 SASI_Hs02_00361411 predicted 454
3 SASI_Hs01_00058000 predicted 205
4 SASI_Hs01_00058001 predicted 1908
5 SASI_Hs02_00361412 predicted 2134
6 SASI_Hs01_00058002 predicted 2040
7 SASI_Hs01_00058003 predicted 1569
8 SASI_Hs01_00058004 predicted 1833
9 SASI_Hs02_00361413 predicted 1629
10 SASI_Hs01_00058006 predicted 1365
11 SASI_Hs01_00058005 predicted 2255
12 SASI_Hs01_00058007 predicted 2338
13 SASI_Hs01_00058008 predicted 1797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138976 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036010 predicted 1960
2 SASI_Rn01_00036011 predicted 1312
3 SASI_Rn01_00036013 predicted 1473
4 SASI_Rn01_00036014 predicted 1335
5 SASI_Rn01_00036015 predicted 446
6 SASI_Rn01_00036016 predicted 1876
7 SASI_Rn01_00036017 predicted 1020
8 SASI_Rn01_00036018 predicted 371
9 SASI_Rn01_00036019 predicted 1853
10 SASI_Rn02_00268409 predicted 1661
11 SASI_Rn01_00036012 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024200 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037353 predicted 2284
2 SASI_Mm01_00037354 predicted 1023
3 SASI_Mm01_00037355 predicted 301
4 SASI_Mm01_00037356 predicted 1555
5 SASI_Mm02_00327544 predicted 1253
6 SASI_Mm02_00327545 predicted 2224
7 SASI_Mm01_00037357 predicted 1240
8 SASI_Mm01_00037358 predicted 612
9 SASI_Mm01_00037359 predicted 586
10 SASI_Mm02_00327546 predicted 2339
11 SASI_Mm01_00037360 predicted 2344
12 SASI_Mm01_00037361 predicted 1883
13 SASI_Mm01_00037362 predicted 2138
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024200
VALIDATED
MFN1 MISSION shRNA Bacterial Glycerol Stock
mitofusin 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024200.4-2085s21c1
Sequence:CCGGTACGGAGCTCTGTACCTTTATCTCGAGATAAAGGTACAGAGCTCCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024200.2-1596s1c1
Sequence:CCGGCGGTGTACCAATGAAGTCAATCTCGAGATTGACTTCATTGGTACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024200.2-2139s1c1
Sequence:CCGGGCGTTTAAGCAGCAGTTTGTACTCGAGTACAAACTGCTGCTTAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024200.2-2603s1c1
Sequence:CCGGGCCTTGTCTTAGCATTAGTTTCTCGAGAAACTAATGCTAAGACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024200.2-1152s1c1
Sequence:CCGGGCAAGATTACAGGAGTTTCAACTCGAGTTGAAACTCCTGTAATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024200.2-1521s1c1
Sequence:CCGGCCCAGTGTACTGAAAGTGTATCTCGAGATACACTTTCAGTACACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024200.3-2138s21c1
Sequence:CCGGGCGTTTAAGCAGCAGTTTGTACTCGAGTACAAACTGCTGCTTAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024200.3-2602s21c1
Sequence:CCGGGCCTTGTCTTAGCATTAGTTTCTCGAGAAACTAATGCTAAGACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024200.3-1520s21c1
Sequence:CCGGCCCAGTGTACTGAAAGTGTATCTCGAGATACACTTTCAGTACACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024200.3-495s21c1
Sequence:CCGGATGCAATGCTGTGGGATAAAGCTCGAGCTTTATCCCACAGCATTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024200
VALIDATED
MFN1 MISSION shRNA shRNA Plasmid DNA
mitofusin 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024200.4-2085s21c1
Sequence:CCGGTACGGAGCTCTGTACCTTTATCTCGAGATAAAGGTACAGAGCTCCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024200.2-1596s1c1
Sequence:CCGGCGGTGTACCAATGAAGTCAATCTCGAGATTGACTTCATTGGTACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024200.2-2139s1c1
Sequence:CCGGGCGTTTAAGCAGCAGTTTGTACTCGAGTACAAACTGCTGCTTAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024200.2-2603s1c1
Sequence:CCGGGCCTTGTCTTAGCATTAGTTTCTCGAGAAACTAATGCTAAGACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024200.2-1152s1c1
Sequence:CCGGGCAAGATTACAGGAGTTTCAACTCGAGTTGAAACTCCTGTAATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024200.2-1521s1c1
Sequence:CCGGCCCAGTGTACTGAAAGTGTATCTCGAGATACACTTTCAGTACACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024200.3-2138s21c1
Sequence:CCGGGCGTTTAAGCAGCAGTTTGTACTCGAGTACAAACTGCTGCTTAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024200.3-2602s21c1
Sequence:CCGGGCCTTGTCTTAGCATTAGTTTCTCGAGAAACTAATGCTAAGACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024200.3-1520s21c1
Sequence:CCGGCCCAGTGTACTGAAAGTGTATCTCGAGATACACTTTCAGTACACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024200.3-495s21c1
Sequence:CCGGATGCAATGCTGTGGGATAAAGCTCGAGCTTTATCCCACAGCATTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024200
VALIDATED
MFN1 MISSION shRNA Lentiviral Transduction Particles
mitofusin 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024200.4-2085s21c1
Sequence:CCGGTACGGAGCTCTGTACCTTTATCTCGAGATAAAGGTACAGAGCTCCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024200.2-1596s1c1
Sequence:CCGGCGGTGTACCAATGAAGTCAATCTCGAGATTGACTTCATTGGTACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024200.2-2139s1c1
Sequence:CCGGGCGTTTAAGCAGCAGTTTGTACTCGAGTACAAACTGCTGCTTAAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024200.2-2603s1c1
Sequence:CCGGGCCTTGTCTTAGCATTAGTTTCTCGAGAAACTAATGCTAAGACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024200.2-1152s1c1
Sequence:CCGGGCAAGATTACAGGAGTTTCAACTCGAGTTGAAACTCCTGTAATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024200.2-1521s1c1
Sequence:CCGGCCCAGTGTACTGAAAGTGTATCTCGAGATACACTTTCAGTACACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024200.3-2138s21c1
Sequence:CCGGGCGTTTAAGCAGCAGTTTGTACTCGAGTACAAACTGCTGCTTAAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024200.3-2602s21c1
Sequence:CCGGGCCTTGTCTTAGCATTAGTTTCTCGAGAAACTAATGCTAAGACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024200.3-1520s21c1
Sequence:CCGGCCCAGTGTACTGAAAGTGTATCTCGAGATACACTTTCAGTACACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024200.3-495s21c1
Sequence:CCGGATGCAATGCTGTGGGATAAAGCTCGAGCTTTATCCCACAGCATTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033540
VALIDATED
MFN1 MISSION shRNA Bacterial Glycerol Stock
mitofusin 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033540.2-432s21c1
Sequence:CCGGTAGTGGGATTGGCCATATAACCTCGAGGTTATATGGCCAATCCCACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033540.2-173s21c1
Sequence:GTACCGGAGGCGATTACTGCAATCTTTGCTCGAGCAAAGATTGCAGTAATCGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_033540.2-927s21c1
Sequence:CCGGGCTCAAAGTTGTAAATGCTTTCTCGAGAAAGCATTTACAACTTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033540.2-801s21c1
Sequence:CCGGGCGGCTTTCCAAGCCTAATATCTCGAGATATTAGGCTTGGAAAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033540.2-3002s21c1
Sequence:CCGGGCTCCCATTATGATTCCAATACTCGAGTATTGGAATCATAATGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033540.2-210s21c1
Sequence:CCGGTGTTACTGAAGGATCACATTTCTCGAGAAATGTGATCCTTCAGTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033540.2-251s21c1
Sequence:GTACCGGATCCGGAACTTGATCGAATAGCTCGAGCTATTCGATCAAGTTCCGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033540
VALIDATED
MFN1 MISSION shRNA shRNA Plasmid DNA
mitofusin 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033540.2-432s21c1
Sequence:CCGGTAGTGGGATTGGCCATATAACCTCGAGGTTATATGGCCAATCCCACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033540.2-173s21c1
Sequence:GTACCGGAGGCGATTACTGCAATCTTTGCTCGAGCAAAGATTGCAGTAATCGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_033540.2-927s21c1
Sequence:CCGGGCTCAAAGTTGTAAATGCTTTCTCGAGAAAGCATTTACAACTTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033540.2-801s21c1
Sequence:CCGGGCGGCTTTCCAAGCCTAATATCTCGAGATATTAGGCTTGGAAAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033540.2-3002s21c1
Sequence:CCGGGCTCCCATTATGATTCCAATACTCGAGTATTGGAATCATAATGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033540.2-210s21c1
Sequence:CCGGTGTTACTGAAGGATCACATTTCTCGAGAAATGTGATCCTTCAGTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033540.2-251s21c1
Sequence:GTACCGGATCCGGAACTTGATCGAATAGCTCGAGCTATTCGATCAAGTTCCGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033540
VALIDATED
MFN1 MISSION shRNA Lentiviral Transduction Particles
mitofusin 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033540.2-432s21c1
Sequence:CCGGTAGTGGGATTGGCCATATAACCTCGAGGTTATATGGCCAATCCCACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033540.2-173s21c1
Sequence:GTACCGGAGGCGATTACTGCAATCTTTGCTCGAGCAAAGATTGCAGTAATCGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_033540.2-927s21c1
Sequence:CCGGGCTCAAAGTTGTAAATGCTTTCTCGAGAAAGCATTTACAACTTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033540.2-801s21c1
Sequence:CCGGGCGGCTTTCCAAGCCTAATATCTCGAGATATTAGGCTTGGAAAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033540.2-3002s21c1
Sequence:CCGGGCTCCCATTATGATTCCAATACTCGAGTATTGGAATCATAATGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033540.2-210s21c1
Sequence:CCGGTGTTACTGAAGGATCACATTTCTCGAGAAATGTGATCCTTCAGTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033540.2-251s21c1
Sequence:GTACCGGATCCGGAACTTGATCGAATAGCTCGAGCTATTCGATCAAGTTCCGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017927
VALIDATED
MFN1 MISSION shRNA Bacterial Glycerol Stock
mitofusin 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000051837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_017927.2-927s1c1
Sequence:CCGGGCTCAAAGTTGTAAATGCTTTCTCGAGAAAGCATTTACAACTTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017927.2-801s1c1
Sequence:CCGGGCGGCTTTCCAAGCCTAATATCTCGAGATATTAGGCTTGGAAAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017927.2-320s1c1
Sequence:CCGGCCATCATTGGTGAGGTGCTATCTCGAGATAGCACCTCACCAATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017927
VALIDATED
MFN1 MISSION shRNA shRNA Plasmid DNA
mitofusin 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000051837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_017927.2-927s1c1
Sequence:CCGGGCTCAAAGTTGTAAATGCTTTCTCGAGAAAGCATTTACAACTTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017927.2-801s1c1
Sequence:CCGGGCGGCTTTCCAAGCCTAATATCTCGAGATATTAGGCTTGGAAAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017927.2-320s1c1
Sequence:CCGGCCATCATTGGTGAGGTGCTATCTCGAGATAGCACCTCACCAATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017927
VALIDATED
MFN1 MISSION shRNA Lentiviral Transduction Particles
mitofusin 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000051837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_017927.2-927s1c1
Sequence:CCGGGCTCAAAGTTGTAAATGCTTTCTCGAGAAAGCATTTACAACTTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017927.2-801s1c1
Sequence:CCGGGCGGCTTTCCAAGCCTAATATCTCGAGATATTAGGCTTGGAAAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017927.2-320s1c1
Sequence:CCGGCCATCATTGGTGAGGTGCTATCTCGAGATAGCACCTCACCAATGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)