EMAIL THIS PAGE TO A FRIEND

MFN2

mitofusin 2

123 Gene Product Result for
Synonyms: CMT2A CMT2A2 CPRP1 HSG MARF
Gene ID:
Human(9927) Summary: This gene encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell proliferation, and it may play a role in the pathophysiology of obesity. Mutations in this gene cause Charcot-Marie-Tooth disease type 2A2, and hereditary motor and sensory neuropathy VI, which are both disorders of the peripheral nervous system. Defects in this gene have also been associated with early-onset stroke. Two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Mouse(170731) mitofusin 2
Rat(64476) mitofusin 2
Zebrafish(567448) mitofusin 2
Horse(100055966) mitofusin 2
cow(534574) mitofusin 2
dog(487439) mitofusin 2
chicken(419484) mitofusin 2
sheep(101110526) mitofusin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV42419 Anti-MFN2 (AB1) antibody produced in rabbit affinity isolated antibody guinea pig, mouse, rabbit, bovine, human, horse, rat, dog
western blot pricing
AV42420 Anti-MFN2 (AB2) antibody produced in rabbit affinity isolated antibody, lyophilized powder horse, mouse, human, bovine, rat, canine, zebrafish, rabbit, chicken
western blot pricing
SAB2108010 Anti-MFN2 antibody produced in rabbit affinity isolated antibody guinea pig, bovine, rat, horse, rabbit, dog, human
immunohistochemistry, western blot pricing
HPA030554 Anti-MFN2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunohistochemistry, western blot pricing
M6444 Anti-Mitofusin 2 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat, mouse
immunoprecipitation (IP), western blot pricing
M9073 Anti-Mitofusin 2 antibody,Mouse monoclonal clone Mito-2, purified from hybridoma cell culture rat, mouse
western blot pricing
M6319 Anti-Mitofusin-2 (N-Terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
immunofluorescence, immunoprecipitation (IP), western blot pricing
WH0009927M3 Monoclonal Anti-MFN2 antibody produced in mouse clone 4H8, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1404765 Monoclonal Anti-MFN2, (C-terminal) antibody produced in mouse clone 6A8, purified immunoglobulin, buffered aqueous solution rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB5201401 Monoclonal Anti-Mitofusin - Alkaline Phosphatase antibody produced in mouse clone S153-5, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201402 Monoclonal Anti-Mitofusin - Apc antibody produced in mouse clone S153-5, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201393 Monoclonal Anti-Mitofusin - Atto 390 antibody produced in mouse clone S153-5, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201394 Monoclonal Anti-Mitofusin - Atto 488 antibody produced in mouse clone S153-5, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201395 Monoclonal Anti-Mitofusin - Atto 565 antibody produced in mouse clone S153-5, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201396 Monoclonal Anti-Mitofusin - Atto 594 antibody produced in mouse clone S153-5, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201397 Monoclonal Anti-Mitofusin - Atto 633 antibody produced in mouse clone S153-5, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201398 Monoclonal Anti-Mitofusin - Atto 655 antibody produced in mouse clone S153-5, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201399 Monoclonal Anti-Mitofusin - Atto 680 antibody produced in mouse clone S153-5, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201400 Monoclonal Anti-Mitofusin - Atto 700 antibody produced in mouse clone S153-5, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201403 Monoclonal Anti-Mitofusin - Biotin antibody produced in mouse clone S153-5, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201404 Monoclonal Anti-Mitofusin - Fitc antibody produced in mouse clone S153-5, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201405 Monoclonal Anti-Mitofusin - Hrp antibody produced in mouse clone S153-5, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201406 Monoclonal Anti-Mitofusin - Pe/Atto 594 antibody produced in mouse clone S153-5, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201407 Monoclonal Anti-Mitofusin - Percp antibody produced in mouse clone S153-5, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201408 Monoclonal Anti-Mitofusin - Rpe antibody produced in mouse clone S153-5, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201409 Monoclonal Anti-Mitofusin - Streptavidin antibody produced in mouse clone S153-5, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201392 Monoclonal Anti-Mitofusin 2 antibody produced in mouse clone S153-5, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133201 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133201 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133201 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014874 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014874 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014874 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127660 Rosetta Predictions human pricing
NM_014874 Rosetta Predictions human pricing
NM_130894 Rosetta Predictions rat pricing
NM_133201 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330014 predicted 841
2 SASI_Hs02_00330015 predicted 638
3 SASI_Hs02_00330016 predicted 1625
4 SASI_Hs02_00330017 predicted 1785
5 SASI_Hs02_00330018 predicted 2466
6 SASI_Hs02_00330019 predicted 907
7 SASI_Hs02_00330020 predicted 1891
8 SASI_Hs02_00330021 predicted 1021
9 SASI_Hs02_00330022 predicted 694
10 SASI_Hs02_00330023 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241186 predicted 990
2 SASI_Hs01_00241187 predicted 781
3 SASI_Hs01_00241188 predicted 1772
4 SASI_Hs01_00241189 predicted 1933
5 SASI_Hs01_00241190 predicted 2615
6 SASI_Hs01_00241191 predicted 1054
7 SASI_Hs01_00241192 predicted 2035
8 SASI_Hs01_00241193 predicted 1167
9 SASI_Hs01_00241194 predicted 837
10 SASI_Hs01_00241195 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130894 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039313 predicted 2065
2 SASI_Rn01_00039315 predicted 2343
3 SASI_Rn01_00039316 predicted 1794
4 SASI_Rn01_00039317 predicted 1756
5 SASI_Rn01_00039318 predicted 2314
6 SASI_Rn02_00267526 predicted 688
7 SASI_Rn02_00267527 predicted 998
8 SASI_Rn01_00039320 predicted 2289
9 SASI_Rn01_00039321 predicted 2127
10 SASI_Rn01_00039322 predicted 1382
11 SASI_Rn01_00039314 predicted 509
12 SASI_Rn01_00039319 predicted 1725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133201 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027313 predicted 1820
2 SASI_Mm01_00027314 predicted 2222
3 SASI_Mm01_00027315 predicted 634
4 SASI_Mm01_00027316 predicted 2309
5 SASI_Mm01_00027317 predicted 2500
6 SASI_Mm01_00027318 predicted 361
7 SASI_Mm01_00027319 predicted 2413
8 SASI_Mm02_00338394 predicted 2286
9 SASI_Mm01_00027320 predicted 1996
10 SASI_Mm01_00027321 predicted 767
11 SASI_Mm01_00027322 predicted 1924
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133201
MFN2 MISSION shRNA Bacterial Glycerol Stock
mitofusin 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133201.2-1337s21c1
Sequence:CCGGGGCAGTTTGAGGAGTGCATTTCTCGAGAAATGCACTCCTCAAACTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133201.1-3270s1c1
Sequence:CCGGCCGGTTTATTAGTGAGAGCTACTCGAGTAGCTCTCACTAATAAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133201.1-1437s1c1
Sequence:CCGGGCGGGTTTATTGTCTAGAAATCTCGAGATTTCTAGACAATAAACCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133201.1-1516s1c1
Sequence:CCGGCAAGACTACAAGCTGCGAATTCTCGAGAATTCGCAGCTTGTAGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133201.1-2295s1c1
Sequence:CCGGGCTACAGCTCATCATCAGTTACTCGAGTAACTGATGATGAGCTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133201.2-933s21c1
Sequence:CCGGGCTGGACAGCTGGATTGATAACTCGAGTTATCAATCCAGCTGTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133201.1-1920s1c1
Sequence:CCGGTGGATGGACTATGCTAGTGAACTCGAGTTCACTAGCATAGTCCATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133201
MFN2 MISSION shRNA shRNA Plasmid DNA
mitofusin 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133201.2-1337s21c1
Sequence:CCGGGGCAGTTTGAGGAGTGCATTTCTCGAGAAATGCACTCCTCAAACTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133201.1-3270s1c1
Sequence:CCGGCCGGTTTATTAGTGAGAGCTACTCGAGTAGCTCTCACTAATAAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133201.1-1437s1c1
Sequence:CCGGGCGGGTTTATTGTCTAGAAATCTCGAGATTTCTAGACAATAAACCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133201.1-1516s1c1
Sequence:CCGGCAAGACTACAAGCTGCGAATTCTCGAGAATTCGCAGCTTGTAGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133201.1-2295s1c1
Sequence:CCGGGCTACAGCTCATCATCAGTTACTCGAGTAACTGATGATGAGCTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133201.2-933s21c1
Sequence:CCGGGCTGGACAGCTGGATTGATAACTCGAGTTATCAATCCAGCTGTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133201.1-1920s1c1
Sequence:CCGGTGGATGGACTATGCTAGTGAACTCGAGTTCACTAGCATAGTCCATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133201
MFN2 MISSION shRNA Lentiviral Transduction Particles
mitofusin 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133201.2-1337s21c1
Sequence:CCGGGGCAGTTTGAGGAGTGCATTTCTCGAGAAATGCACTCCTCAAACTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133201.1-3270s1c1
Sequence:CCGGCCGGTTTATTAGTGAGAGCTACTCGAGTAGCTCTCACTAATAAACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133201.1-1437s1c1
Sequence:CCGGGCGGGTTTATTGTCTAGAAATCTCGAGATTTCTAGACAATAAACCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133201.1-1516s1c1
Sequence:CCGGCAAGACTACAAGCTGCGAATTCTCGAGAATTCGCAGCTTGTAGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133201.1-2295s1c1
Sequence:CCGGGCTACAGCTCATCATCAGTTACTCGAGTAACTGATGATGAGCTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133201.2-933s21c1
Sequence:CCGGGCTGGACAGCTGGATTGATAACTCGAGTTATCAATCCAGCTGTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133201.1-1920s1c1
Sequence:CCGGTGGATGGACTATGCTAGTGAACTCGAGTTCACTAGCATAGTCCATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014874
MFN2 MISSION shRNA Bacterial Glycerol Stock
mitofusin 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000082686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014874.2-412s1c1
Sequence:CCGGGCACTTTGTCACTGCCAAGAACTCGAGTTCTTGGCAGTGACAAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014874.2-554s1c1
Sequence:CCGGGTCAAAGGTTACCTATCCAAACTCGAGTTTGGATAGGTAACCTTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014874.2-3106s1c1
Sequence:CCGGGCTCAGTGCTTCATCCCATTTCTCGAGAAATGGGATGAAGCACTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014874.2-1480s1c1
Sequence:CCGGGCAGGTTTACTGCGAGGAAATCTCGAGATTTCCTCGCAGTAAACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014874
MFN2 MISSION shRNA shRNA Plasmid DNA
mitofusin 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000082686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014874.2-412s1c1
Sequence:CCGGGCACTTTGTCACTGCCAAGAACTCGAGTTCTTGGCAGTGACAAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014874.2-554s1c1
Sequence:CCGGGTCAAAGGTTACCTATCCAAACTCGAGTTTGGATAGGTAACCTTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014874.2-3106s1c1
Sequence:CCGGGCTCAGTGCTTCATCCCATTTCTCGAGAAATGGGATGAAGCACTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014874.2-1480s1c1
Sequence:CCGGGCAGGTTTACTGCGAGGAAATCTCGAGATTTCCTCGCAGTAAACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014874
MFN2 MISSION shRNA Lentiviral Transduction Particles
mitofusin 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000082686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014874.2-412s1c1
Sequence:CCGGGCACTTTGTCACTGCCAAGAACTCGAGTTCTTGGCAGTGACAAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014874.2-554s1c1
Sequence:CCGGGTCAAAGGTTACCTATCCAAACTCGAGTTTGGATAGGTAACCTTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014874.2-3106s1c1
Sequence:CCGGGCTCAGTGCTTCATCCCATTTCTCGAGAAATGGGATGAAGCACTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014874.2-1480s1c1
Sequence:CCGGGCAGGTTTACTGCGAGGAAATCTCGAGATTTCCTCGCAGTAAACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)