EMAIL THIS PAGE TO A FRIEND

MFRP

membrane frizzled-related protein

57 Gene Product Result for
Synonyms: MCOP5 NNO2 RD6
UniProtKB ID: Q9BY79, B0YJ36, B0YJ37, Q335M3, Q96DQ9
Gene ID:
Human(83552) Summary: This gene encodes a member of the frizzled-related protein family. The encoded protein plays an important role in eye development and mutations in this gene have been associated with nanophthalmos, posterior microphthalmia, retinitis pigmentosa, foveoschisis, and optic disc drusen. The protein is encoded by a bicistronic transcript which also encodes C1q and tumor necrosis factor related protein 5 (C1QTNF5). [provided by RefSeq, Jun 2013]
Mouse(259172) membrane-type frizzled-related protein
Rat(315597) membrane frizzled-related protein
chicken(100859299) membrane frizzled-related protein
cow(522979) membrane frizzled-related protein
Horse(100071432) membrane frizzled-related protein
domestic cat(101097514) membrane frizzled-related protein
dog(489366) membrane frizzled-related protein
sheep(101109206) membrane frizzled-related protein
domestic guinea pig(100717383) membrane frizzled-related protein
naked mole-rat(101711581) membrane frizzled-related protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1582 Human MFRP ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031433 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031433 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031433 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_147126 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_147126 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_147126 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031433 Rosetta Predictions human pricing
NM_001108137 Rosetta Predictions rat pricing
NM_147126 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084689 predicted 1437
2 SASI_Hs01_00084690 predicted 1150
3 SASI_Hs01_00084691 predicted 1971
4 SASI_Hs01_00084692 predicted 1117
5 SASI_Hs01_00084693 predicted 774
6 SASI_Hs01_00084694 predicted 1381
7 SASI_Hs01_00084695 predicted 1445
8 SASI_Hs01_00084696 predicted 1592
9 SASI_Hs01_00084697 predicted 1072
10 SASI_Hs01_00084698 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235724 predicted 1490
2 SASI_Rn02_00235725 predicted 773
3 SASI_Rn02_00235726 predicted 1347
4 SASI_Rn02_00235727 predicted 1677
5 SASI_Rn02_00235728 predicted 1250
6 SASI_Rn02_00235729 predicted 1176
7 SASI_Rn02_00235730 predicted 1392
8 SASI_Rn02_00235731 predicted 1693
9 SASI_Rn02_00235732 predicted 1006
10 SASI_Rn02_00235733 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098780 predicted 1711
2 SASI_Mm01_00098781 predicted 1369
3 SASI_Mm01_00098782 predicted 639
4 SASI_Mm01_00098783 predicted 614
5 SASI_Mm01_00098784 predicted 1356
6 SASI_Mm01_00098785 predicted 1077
7 SASI_Mm01_00098786 predicted 988
8 SASI_Mm01_00098787 predicted 1572
9 SASI_Mm01_00098788 predicted 1398
10 SASI_Mm01_00098789 predicted 1034
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031433
MFRP MISSION shRNA Bacterial Glycerol Stock
membrane frizzled-related protein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031433.1-859s1c1
Sequence:CCGGGACAGCAGTGTGGAAGGATTTCTCGAGAAATCCTTCCACACTGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031433.2-2076s21c1
Sequence:CCGGTGCTCCTTCCTGTCCCTTTACCTCGAGGTAAAGGGACAGGAAGGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031433.1-1324s1c1
Sequence:CCGGGCTGTGCTGTTTAGGACAGATCTCGAGATCTGTCCTAAACAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031433.1-688s1c1
Sequence:CCGGGCAATACAGCTCAAGATCGAACTCGAGTTCGATCTTGAGCTGTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031433.1-2306s1c1
Sequence:CCGGACCCTCATCTCTCTGCGTATTCTCGAGAATACGCAGAGAGATGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031433.2-1654s21c1
Sequence:CCGGAGAGGTCCTCAGCGGTTACAACTCGAGTTGTAACCGCTGAGGACCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031433.2-1020s21c1
Sequence:CCGGACGGCAGTGATGAGACCAATTCTCGAGAATTGGTCTCATCACTGCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031433
MFRP MISSION shRNA shRNA Plasmid DNA
membrane frizzled-related protein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031433.1-859s1c1
Sequence:CCGGGACAGCAGTGTGGAAGGATTTCTCGAGAAATCCTTCCACACTGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031433.2-2076s21c1
Sequence:CCGGTGCTCCTTCCTGTCCCTTTACCTCGAGGTAAAGGGACAGGAAGGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031433.1-1324s1c1
Sequence:CCGGGCTGTGCTGTTTAGGACAGATCTCGAGATCTGTCCTAAACAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031433.1-688s1c1
Sequence:CCGGGCAATACAGCTCAAGATCGAACTCGAGTTCGATCTTGAGCTGTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031433.1-2306s1c1
Sequence:CCGGACCCTCATCTCTCTGCGTATTCTCGAGAATACGCAGAGAGATGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031433.2-1654s21c1
Sequence:CCGGAGAGGTCCTCAGCGGTTACAACTCGAGTTGTAACCGCTGAGGACCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031433.2-1020s21c1
Sequence:CCGGACGGCAGTGATGAGACCAATTCTCGAGAATTGGTCTCATCACTGCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031433
MFRP MISSION shRNA Lentiviral Transduction Particles
membrane frizzled-related protein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031433.1-859s1c1
Sequence:CCGGGACAGCAGTGTGGAAGGATTTCTCGAGAAATCCTTCCACACTGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031433.2-2076s21c1
Sequence:CCGGTGCTCCTTCCTGTCCCTTTACCTCGAGGTAAAGGGACAGGAAGGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031433.1-1324s1c1
Sequence:CCGGGCTGTGCTGTTTAGGACAGATCTCGAGATCTGTCCTAAACAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031433.1-688s1c1
Sequence:CCGGGCAATACAGCTCAAGATCGAACTCGAGTTCGATCTTGAGCTGTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031433.1-2306s1c1
Sequence:CCGGACCCTCATCTCTCTGCGTATTCTCGAGAATACGCAGAGAGATGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031433.2-1654s21c1
Sequence:CCGGAGAGGTCCTCAGCGGTTACAACTCGAGTTGTAACCGCTGAGGACCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031433.2-1020s21c1
Sequence:CCGGACGGCAGTGATGAGACCAATTCTCGAGAATTGGTCTCATCACTGCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147126
MFRP MISSION shRNA Bacterial Glycerol Stock
membrane frizzled-related protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147126.1-3621s1c1
Sequence:CCGGCGCCTCTTTCTTCCAGTATTTCTCGAGAAATACTGGAAGAAAGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147126.1-730s1c1
Sequence:CCGGCCTGCCACATTAAACACCAATCTCGAGATTGGTGTTTAATGTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147126.1-1372s1c1
Sequence:CCGGCTGCAATGGATGTGTGACTTACTCGAGTAAGTCACACATCCATTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147126.1-606s1c1
Sequence:CCGGCCAGACAATACAGCTCAAGATCTCGAGATCTTGAGCTGTATTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147126.1-1246s1c1
Sequence:CCGGGCTGTAATCTTCAAGACGGATCTCGAGATCCGTCTTGAAGATTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147126
MFRP MISSION shRNA shRNA Plasmid DNA
membrane frizzled-related protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147126.1-3621s1c1
Sequence:CCGGCGCCTCTTTCTTCCAGTATTTCTCGAGAAATACTGGAAGAAAGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147126.1-730s1c1
Sequence:CCGGCCTGCCACATTAAACACCAATCTCGAGATTGGTGTTTAATGTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147126.1-1372s1c1
Sequence:CCGGCTGCAATGGATGTGTGACTTACTCGAGTAAGTCACACATCCATTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147126.1-606s1c1
Sequence:CCGGCCAGACAATACAGCTCAAGATCTCGAGATCTTGAGCTGTATTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147126.1-1246s1c1
Sequence:CCGGGCTGTAATCTTCAAGACGGATCTCGAGATCCGTCTTGAAGATTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147126
MFRP MISSION shRNA Lentiviral Transduction Particles
membrane frizzled-related protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147126.1-3621s1c1
Sequence:CCGGCGCCTCTTTCTTCCAGTATTTCTCGAGAAATACTGGAAGAAAGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147126.1-730s1c1
Sequence:CCGGCCTGCCACATTAAACACCAATCTCGAGATTGGTGTTTAATGTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147126.1-1372s1c1
Sequence:CCGGCTGCAATGGATGTGTGACTTACTCGAGTAAGTCACACATCCATTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147126.1-606s1c1
Sequence:CCGGCCAGACAATACAGCTCAAGATCTCGAGATCTTGAGCTGTATTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147126.1-1246s1c1
Sequence:CCGGGCTGTAATCTTCAAGACGGATCTCGAGATCCGTCTTGAAGATTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)