EMAIL THIS PAGE TO A FRIEND

MFSD11

major facilitator superfamily domain containing 11

106 Gene Product Result for
Synonyms: ET
UniProtKB ID: O43934, O43442, Q9NXI5
Gene ID:
Mouse(69900) major facilitator superfamily domain containing 11
Rat(360667) major facilitator superfamily domain containing 11
Zebrafish(570782) major facilitator superfamily domain containing 11
chicken(417352) major facilitator superfamily domain containing 11
cow(518635) major facilitator superfamily domain containing 11
domestic cat(101086612) major facilitator superfamily domain containing 11
dog(483336) major facilitator superfamily domain containing 11
naked mole-rat(101720242) major facilitator superfamily domain containing 11
Domestic Rabbit(100355001) major facilitator superfamily domain containing 11
domestic guinea pig(100722963) major facilitator superfamily domain containing 11
sheep(101102574) major facilitator superfamily domain containing 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024311 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024311 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024311 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178620 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178620 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178620 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024311 Rosetta Predictions human pricing
NM_001108308 Rosetta Predictions rat pricing
XM_340942 Rosetta Predictions rat pricing
NM_178620 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142671 predicted 1248
2 SASI_Hs01_00142672 predicted 331
3 SASI_Hs01_00142673 predicted 1404
4 SASI_Hs01_00142674 predicted 393
5 SASI_Hs01_00142675 predicted 985
6 SASI_Hs01_00142676 predicted 418
7 SASI_Hs01_00142677 predicted 968
8 SASI_Hs01_00142678 predicted 1359
9 SASI_Hs01_00142679 predicted 909
10 SASI_Hs01_00142680 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237379 predicted 361
2 SASI_Rn02_00237380 predicted 1085
3 SASI_Rn02_00237381 predicted 428
4 SASI_Rn02_00237382 predicted 619
5 SASI_Rn02_00237383 predicted 398
6 SASI_Rn02_00237384 predicted 367
7 SASI_Rn02_00237385 predicted 1421
8 SASI_Rn02_00237386 predicted 1701
9 SASI_Rn02_00237387 predicted 735
10 SASI_Rn02_00237388 predicted 1602
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340942 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00125241 predicted 235
2 SASI_Rn01_00125242 predicted 574
3 SASI_Rn01_00125243 predicted 649
4 SASI_Rn01_00125244 predicted 881
5 SASI_Rn01_00125245 predicted 484
6 SASI_Rn01_00125246 predicted 342
7 SASI_Rn01_00125247 predicted 300
8 SASI_Rn01_00125248 predicted 553
9 SASI_Rn01_00125249 predicted 504
10 SASI_Rn01_00125250 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178620 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136863 predicted 1444
2 SASI_Mm01_00136864 predicted 1171
3 SASI_Mm01_00136865 predicted 1106
4 SASI_Mm01_00136866 predicted 1273
5 SASI_Mm01_00136868 predicted 295
6 SASI_Mm01_00136869 predicted 199
7 SASI_Mm02_00348982 predicted 882
8 SASI_Mm02_00348983 predicted 402
9 SASI_Mm01_00136871 predicted 1024
10 SASI_Mm01_00136872 predicted 371
11 SASI_Mm01_00136867 predicted 638
12 SASI_Mm01_00136870 predicted 1487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024311
MFSD11 MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 11
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024311.2-1746s1c1
Sequence:CCGGCCAGAGTTGGTGTTCAAGTTTCTCGAGAAACTTGAACACCAACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024311.2-1287s1c1
Sequence:CCGGGCTTACATCAAATCCAGCAAACTCGAGTTTGCTGGATTTGATGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024311.2-1367s1c1
Sequence:CCGGGCTGCTTAGTATCTTGGGCTTCTCGAGAAGCCCAAGATACTAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024311.2-324s1c1
Sequence:CCGGGCCTTTCAAACTTGTGGAAATCTCGAGATTTCCACAAGTTTGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024311.2-1148s1c1
Sequence:CCGGGCTGAGCAAGAACAATCGTTTCTCGAGAAACGATTGTTCTTGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024311.2-1443s21c1
Sequence:CCGGATTTGCGCAGCCGTGGCATTTCTCGAGAAATGCCACGGCTGCGCAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024311.2-967s21c1
Sequence:CCGGAGATGCTCCTTCTTAGTATTACTCGAGTAATACTAAGAAGGAGCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024311
MFSD11 MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 11
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024311.2-1746s1c1
Sequence:CCGGCCAGAGTTGGTGTTCAAGTTTCTCGAGAAACTTGAACACCAACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024311.2-1287s1c1
Sequence:CCGGGCTTACATCAAATCCAGCAAACTCGAGTTTGCTGGATTTGATGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024311.2-1367s1c1
Sequence:CCGGGCTGCTTAGTATCTTGGGCTTCTCGAGAAGCCCAAGATACTAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024311.2-324s1c1
Sequence:CCGGGCCTTTCAAACTTGTGGAAATCTCGAGATTTCCACAAGTTTGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024311.2-1148s1c1
Sequence:CCGGGCTGAGCAAGAACAATCGTTTCTCGAGAAACGATTGTTCTTGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024311.2-1443s21c1
Sequence:CCGGATTTGCGCAGCCGTGGCATTTCTCGAGAAATGCCACGGCTGCGCAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024311.2-967s21c1
Sequence:CCGGAGATGCTCCTTCTTAGTATTACTCGAGTAATACTAAGAAGGAGCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024311
MFSD11 MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 11
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024311.2-1746s1c1
Sequence:CCGGCCAGAGTTGGTGTTCAAGTTTCTCGAGAAACTTGAACACCAACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024311.2-1287s1c1
Sequence:CCGGGCTTACATCAAATCCAGCAAACTCGAGTTTGCTGGATTTGATGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024311.2-1367s1c1
Sequence:CCGGGCTGCTTAGTATCTTGGGCTTCTCGAGAAGCCCAAGATACTAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024311.2-324s1c1
Sequence:CCGGGCCTTTCAAACTTGTGGAAATCTCGAGATTTCCACAAGTTTGAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024311.2-1148s1c1
Sequence:CCGGGCTGAGCAAGAACAATCGTTTCTCGAGAAACGATTGTTCTTGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024311.2-1443s21c1
Sequence:CCGGATTTGCGCAGCCGTGGCATTTCTCGAGAAATGCCACGGCTGCGCAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024311.2-967s21c1
Sequence:CCGGAGATGCTCCTTCTTAGTATTACTCGAGTAATACTAAGAAGGAGCATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178620
VALIDATED
MFSD11 MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178620.3-2480s1c1
Sequence:CCGGCCACCATATCTAATGACAATACTCGAGTATTGTCATTAGATATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178620.3-890s1c1
Sequence:CCGGGCCTCATTGGACTTTCTGGAACTCGAGTTCCAGAAAGTCCAATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178620.3-634s1c1
Sequence:CCGGCGGAAACCAGATCCTGAGAATCTCGAGATTCTCAGGATCTGGTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178620.3-373s1c1
Sequence:CCGGGCATCTGTCTTCATCGGAATTCTCGAGAATTCCGATGAAGACAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178620.3-174s1c1
Sequence:CCGGGAGCTTAAATAGCACAGATTTCTCGAGAAATCTGTGCTATTTAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178620
VALIDATED
MFSD11 MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178620.3-2480s1c1
Sequence:CCGGCCACCATATCTAATGACAATACTCGAGTATTGTCATTAGATATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178620.3-890s1c1
Sequence:CCGGGCCTCATTGGACTTTCTGGAACTCGAGTTCCAGAAAGTCCAATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178620.3-634s1c1
Sequence:CCGGCGGAAACCAGATCCTGAGAATCTCGAGATTCTCAGGATCTGGTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178620.3-373s1c1
Sequence:CCGGGCATCTGTCTTCATCGGAATTCTCGAGAATTCCGATGAAGACAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178620.3-174s1c1
Sequence:CCGGGAGCTTAAATAGCACAGATTTCTCGAGAAATCTGTGCTATTTAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178620
VALIDATED
MFSD11 MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178620.3-2480s1c1
Sequence:CCGGCCACCATATCTAATGACAATACTCGAGTATTGTCATTAGATATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178620.3-890s1c1
Sequence:CCGGGCCTCATTGGACTTTCTGGAACTCGAGTTCCAGAAAGTCCAATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178620.3-634s1c1
Sequence:CCGGCGGAAACCAGATCCTGAGAATCTCGAGATTCTCAGGATCTGGTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178620.3-373s1c1
Sequence:CCGGGCATCTGTCTTCATCGGAATTCTCGAGAATTCCGATGAAGACAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178620.3-174s1c1
Sequence:CCGGGAGCTTAAATAGCACAGATTTCTCGAGAAATCTGTGCTATTTAAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)