EMAIL THIS PAGE TO A FRIEND

MFSD1

major facilitator superfamily domain containing 1

85 Gene Product Result for
Synonyms: SMAP4
Gene ID:
Mouse(66868) major facilitator superfamily domain containing 1
Rat(361957) major facilitator superfamily domain containing 1
Zebrafish(641486) major facilitator superfamily domain containing 1
chicken(425017) major facilitator superfamily domain containing 1
dog(488129) major facilitator superfamily domain containing 1
domestic cat(101094444) major facilitator superfamily domain containing 1
cow(508337) major facilitator superfamily domain containing 1
naked mole-rat(101698383) major facilitator superfamily domain containing 1
domestic guinea pig(100728733) major facilitator superfamily domain containing 1
sheep(101119275) major facilitator superfamily domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025813 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025813 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025813 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022736 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022736 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022736 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022736 Rosetta Predictions human pricing
XM_001061503 Rosetta Predictions rat pricing
XM_001061558 Rosetta Predictions rat pricing
XM_342258 Rosetta Predictions rat pricing
NM_025813 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203461 predicted 1367
2 SASI_Hs01_00203462 predicted 1443
3 SASI_Hs01_00203464 predicted 932
4 SASI_Hs01_00203466 predicted 938
5 SASI_Hs02_00355975 predicted 610
6 SASI_Hs01_00203468 predicted 230
7 SASI_Hs01_00203469 predicted 465
8 SASI_Hs02_00355976 predicted 726
9 SASI_Hs01_00203470 predicted 1199
10 SASI_Hs02_00355977 predicted 500
11 SASI_Hs01_00203463 predicted 691
12 SASI_Hs01_00203465 predicted 451
13 SASI_Hs01_00203467 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300317 predicted 303
2 SASI_Rn02_00300318 predicted 1359
3 SASI_Rn02_00300319 predicted 563
4 SASI_Rn02_00300320 predicted 248
5 SASI_Rn02_00300321 predicted 1155
6 SASI_Rn02_00300322 predicted 194
7 SASI_Rn02_00300323 predicted 347
8 SASI_Rn02_00300324 predicted 903
9 SASI_Rn02_00300325 predicted 376
10 SASI_Rn02_00300326 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300493 predicted 307
2 SASI_Rn02_00300494 predicted 1358
3 SASI_Rn02_00300495 predicted 255
4 SASI_Rn02_00300496 predicted 1162
5 SASI_Rn02_00300497 predicted 199
6 SASI_Rn02_00300498 predicted 488
7 SASI_Rn02_00300499 predicted 338
8 SASI_Rn02_00300500 predicted 906
9 SASI_Rn02_00300501 predicted 380
10 SASI_Rn02_00300502 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342258 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394007 predicted 309
2 SASI_Rn02_00394008 predicted 1364
3 SASI_Rn02_00394009 predicted 253
4 SASI_Rn02_00394010 predicted 1168
5 SASI_Rn02_00394011 predicted 199
6 SASI_Rn02_00394012 predicted 486
7 SASI_Rn02_00394013 predicted 344
8 SASI_Rn02_00394014 predicted 911
9 SASI_Rn02_00394015 predicted 377
10 SASI_Rn02_00394016 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025813 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196067 predicted 964
2 SASI_Mm01_00196068 predicted 688
3 SASI_Mm01_00196069 predicted 300
4 SASI_Mm01_00196070 predicted 392
5 SASI_Mm01_00196071 predicted 948
6 SASI_Mm01_00196072 predicted 812
7 SASI_Mm01_00196074 predicted 887
8 SASI_Mm02_00329054 predicted 250
9 SASI_Mm01_00196075 predicted 598
10 SASI_Mm01_00196076 predicted 1292
11 SASI_Mm01_00196073 predicted 534
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025813
MFSD1 MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025813.1-996s1c1
Sequence:CCGGGTCTCCATTATTTGGACTCTTCTCGAGAAGAGTCCAAATAATGGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025813.1-687s1c1
Sequence:CCGGGACACTTATGATTGGGTGTATCTCGAGATACACCCAATCATAAGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025813.1-2107s1c1
Sequence:CCGGCCAGAAATCAAATCTGCAATACTCGAGTATTGCAGATTTGATTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025813.1-689s1c1
Sequence:CCGGCACTTATGATTGGGTGTATAACTCGAGTTATACACCCAATCATAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025813.3-407s21c1
Sequence:CCGGTTGCATCGGACAGGTTATATTCTCGAGAATATAACCTGTCCGATGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025813.3-995s21c1
Sequence:CCGGGTCTCCATTATTTGGACTCTTCTCGAGAAGAGTCCAAATAATGGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025813.3-2106s21c1
Sequence:CCGGCCAGAAATCAAATCTGCAATACTCGAGTATTGCAGATTTGATTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025813.3-688s21c1
Sequence:CCGGCACTTATGATTGGGTGTATAACTCGAGTTATACACCCAATCATAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025813
MFSD1 MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025813.1-996s1c1
Sequence:CCGGGTCTCCATTATTTGGACTCTTCTCGAGAAGAGTCCAAATAATGGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025813.1-687s1c1
Sequence:CCGGGACACTTATGATTGGGTGTATCTCGAGATACACCCAATCATAAGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025813.1-2107s1c1
Sequence:CCGGCCAGAAATCAAATCTGCAATACTCGAGTATTGCAGATTTGATTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025813.1-689s1c1
Sequence:CCGGCACTTATGATTGGGTGTATAACTCGAGTTATACACCCAATCATAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025813.3-407s21c1
Sequence:CCGGTTGCATCGGACAGGTTATATTCTCGAGAATATAACCTGTCCGATGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025813.3-995s21c1
Sequence:CCGGGTCTCCATTATTTGGACTCTTCTCGAGAAGAGTCCAAATAATGGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025813.3-2106s21c1
Sequence:CCGGCCAGAAATCAAATCTGCAATACTCGAGTATTGCAGATTTGATTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025813.3-688s21c1
Sequence:CCGGCACTTATGATTGGGTGTATAACTCGAGTTATACACCCAATCATAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025813
MFSD1 MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025813.1-996s1c1
Sequence:CCGGGTCTCCATTATTTGGACTCTTCTCGAGAAGAGTCCAAATAATGGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025813.1-687s1c1
Sequence:CCGGGACACTTATGATTGGGTGTATCTCGAGATACACCCAATCATAAGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025813.1-2107s1c1
Sequence:CCGGCCAGAAATCAAATCTGCAATACTCGAGTATTGCAGATTTGATTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025813.1-689s1c1
Sequence:CCGGCACTTATGATTGGGTGTATAACTCGAGTTATACACCCAATCATAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025813.3-407s21c1
Sequence:CCGGTTGCATCGGACAGGTTATATTCTCGAGAATATAACCTGTCCGATGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025813.3-995s21c1
Sequence:CCGGGTCTCCATTATTTGGACTCTTCTCGAGAAGAGTCCAAATAATGGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025813.3-2106s21c1
Sequence:CCGGCCAGAAATCAAATCTGCAATACTCGAGTATTGCAGATTTGATTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025813.3-688s21c1
Sequence:CCGGCACTTATGATTGGGTGTATAACTCGAGTTATACACCCAATCATAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022736
VALIDATED
MFSD1 MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_022736.1-660s1c1
Sequence:CCGGCCTCGGGATCACACTTATGATCTCGAGATCATAAGTGTGATCCCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_022736.1-485s1c1
Sequence:CCGGCCTTAGCAGTTGCCCAGAATACTCGAGTATTCTGGGCAACTGCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022736.1-1336s1c1
Sequence:CCGGGTCTTACTCTATTTGGTGAATCTCGAGATTCACCAAATAGAGTAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_022736.1-252s1c1
Sequence:CCGGGCAAGTGAATACCACGAAATTCTCGAGAATTTCGTGGTATTCACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022736.1-1159s1c1
Sequence:CCGGGTGGCATTTGTAGTTCCTGAACTCGAGTTCAGGAACTACAAATGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_022736.1-1328s21c1
Sequence:CCGGTATCTGTGGTCTTACTCTATTCTCGAGAATAGAGTAAGACCACAGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022736.1-1223s21c1
Sequence:CCGGATCTTGGGTTGGCCATCATTTCTCGAGAAATGATGGCCAACCCAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_022736.1-252s21c1
Sequence:CCGGGCAAGTGAATACCACGAAATTCTCGAGAATTTCGTGGTATTCACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_022736.1-223s21c1
Sequence:CCGGGCCCTTCAGACTCAAGTTAAACTCGAGTTTAACTTGAGTCTGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_022736.1-1885s21c1
Sequence:CCGGGGGCATAATGCTAGGGAATATCTCGAGATATTCCCTAGCATTATGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022736
VALIDATED
MFSD1 MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_022736.1-660s1c1
Sequence:CCGGCCTCGGGATCACACTTATGATCTCGAGATCATAAGTGTGATCCCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_022736.1-485s1c1
Sequence:CCGGCCTTAGCAGTTGCCCAGAATACTCGAGTATTCTGGGCAACTGCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022736.1-1336s1c1
Sequence:CCGGGTCTTACTCTATTTGGTGAATCTCGAGATTCACCAAATAGAGTAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_022736.1-252s1c1
Sequence:CCGGGCAAGTGAATACCACGAAATTCTCGAGAATTTCGTGGTATTCACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022736.1-1159s1c1
Sequence:CCGGGTGGCATTTGTAGTTCCTGAACTCGAGTTCAGGAACTACAAATGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_022736.1-1328s21c1
Sequence:CCGGTATCTGTGGTCTTACTCTATTCTCGAGAATAGAGTAAGACCACAGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022736.1-1223s21c1
Sequence:CCGGATCTTGGGTTGGCCATCATTTCTCGAGAAATGATGGCCAACCCAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_022736.1-252s21c1
Sequence:CCGGGCAAGTGAATACCACGAAATTCTCGAGAATTTCGTGGTATTCACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_022736.1-223s21c1
Sequence:CCGGGCCCTTCAGACTCAAGTTAAACTCGAGTTTAACTTGAGTCTGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_022736.1-1885s21c1
Sequence:CCGGGGGCATAATGCTAGGGAATATCTCGAGATATTCCCTAGCATTATGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022736
VALIDATED
MFSD1 MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_022736.1-660s1c1
Sequence:CCGGCCTCGGGATCACACTTATGATCTCGAGATCATAAGTGTGATCCCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_022736.1-485s1c1
Sequence:CCGGCCTTAGCAGTTGCCCAGAATACTCGAGTATTCTGGGCAACTGCTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022736.1-1336s1c1
Sequence:CCGGGTCTTACTCTATTTGGTGAATCTCGAGATTCACCAAATAGAGTAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_022736.1-252s1c1
Sequence:CCGGGCAAGTGAATACCACGAAATTCTCGAGAATTTCGTGGTATTCACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022736.1-1159s1c1
Sequence:CCGGGTGGCATTTGTAGTTCCTGAACTCGAGTTCAGGAACTACAAATGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_022736.1-1328s21c1
Sequence:CCGGTATCTGTGGTCTTACTCTATTCTCGAGAATAGAGTAAGACCACAGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022736.1-1223s21c1
Sequence:CCGGATCTTGGGTTGGCCATCATTTCTCGAGAAATGATGGCCAACCCAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_022736.1-252s21c1
Sequence:CCGGGCAAGTGAATACCACGAAATTCTCGAGAATTTCGTGGTATTCACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_022736.1-223s21c1
Sequence:CCGGGCCCTTCAGACTCAAGTTAAACTCGAGTTTAACTTGAGTCTGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_022736.1-1885s21c1
Sequence:CCGGGGGCATAATGCTAGGGAATATCTCGAGATATTCCCTAGCATTATGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)