EMAIL THIS PAGE TO A FRIEND

MFSD2A

major facilitator superfamily domain containing 2A

68 Gene Product Result for
Synonyms: MFSD2
UniProtKB ID: Q8NA29, A8K675, Q6UWU5, Q96F59, Q9BRC8
Gene ID:
Mouse(76574) major facilitator superfamily domain containing 2A
Rat(298504) major facilitator superfamily domain containing 2A
chicken(419679) major facilitator superfamily domain containing 2A
cow(512633) major facilitator superfamily domain containing 2A
Horse(100068365) major facilitator superfamily domain containing 2A
domestic cat(101090124) major facilitator superfamily domain containing 2A
dog(475318) major facilitator superfamily domain containing 2A
naked mole-rat(101716851) major facilitator superfamily domain containing 2A
domestic guinea pig(100719738) major facilitator superfamily domain containing 2A
sheep(101120365) major facilitator superfamily domain containing 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA043107 Anti-MFSD2A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2900890 Anti-MFSD2A antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032793 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032793 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032793 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029662 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029662 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029662 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032793 Rosetta Predictions human pricing
NM_001106683 Rosetta Predictions rat pricing
NM_029662 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164414 predicted 1128
2 SASI_Hs01_00164415 predicted 578
3 SASI_Hs01_00164416 predicted 493
4 SASI_Hs01_00164417 predicted 1027
5 SASI_Hs01_00164418 predicted 628
6 SASI_Hs01_00164419 predicted 1169
7 SASI_Hs01_00164420 predicted 961
8 SASI_Hs01_00164421 predicted 1226
9 SASI_Hs01_00164422 predicted 1235
10 SASI_Hs01_00164423 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106683 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221358 predicted 1296
2 SASI_Rn02_00221359 predicted 1328
3 SASI_Rn02_00221360 predicted 829
4 SASI_Rn02_00221361 predicted 899
5 SASI_Rn02_00221362 predicted 529
6 SASI_Rn02_00221363 predicted 1466
7 SASI_Rn02_00221364 predicted 267
8 SASI_Rn02_00221365 predicted 1307
9 SASI_Rn02_00221366 predicted 1226
10 SASI_Rn02_00221367 predicted 1290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029662 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087470 predicted 1722
2 SASI_Mm01_00087471 predicted 1279
3 SASI_Mm01_00087472 predicted 1216
4 SASI_Mm01_00087473 predicted 888
5 SASI_Mm01_00087474 predicted 1573
6 SASI_Mm01_00087475 predicted 1451
7 SASI_Mm01_00087476 predicted 261
8 SASI_Mm01_00087477 predicted 649
9 SASI_Mm01_00087478 predicted 744
10 SASI_Mm01_00087479 predicted 1296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032793
MFSD2A MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 2A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032793.2-1283s1c1
Sequence:CCGGCATGGAGAGTAACCTCATCATCTCGAGATGATGAGGTTACTCTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140378    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032793.2-1999s1c1
Sequence:CCGGGCCCGGAACACTAATGTAGAACTCGAGTTCTACATTAGTGTTCCGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032793.2-1026s1c1
Sequence:CCGGCACGGCCCATACATCAAACTTCTCGAGAAGTTTGATGTATGGGCCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032793.2-1474s1c1
Sequence:CCGGGAGTGTCACTGGGCATTTCTACTCGAGTAGAAATGCCCAGTGACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032793.2-1965s1c1
Sequence:CCGGCCACTGTGAATATGCCAAGGACTCGAGTCCTTGGCATATTCACAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032793.2-819s1c1
Sequence:CCGGGCTTCACAAAGTGCCAACCATCTCGAGATGGTTGGCACTTTGTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032793.3-1392s21c1
Sequence:CCGGCCATGCTGCCTGATGTCATTGCTCGAGCAATGACATCAGGCAGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032793.3-1187s21c1
Sequence:CCGGATCATGCTCTCGGCCACTTTACTCGAGTAAAGTGGCCGAGAGCATGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032793.3-1566s21c1
Sequence:CCGGAGCCGGAACGTGTCAAGTTTACTCGAGTAAACTTGACACGTTCCGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032793
MFSD2A MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 2A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032793.2-1283s1c1
Sequence:CCGGCATGGAGAGTAACCTCATCATCTCGAGATGATGAGGTTACTCTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140378    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032793.2-1999s1c1
Sequence:CCGGGCCCGGAACACTAATGTAGAACTCGAGTTCTACATTAGTGTTCCGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032793.2-1026s1c1
Sequence:CCGGCACGGCCCATACATCAAACTTCTCGAGAAGTTTGATGTATGGGCCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032793.2-1474s1c1
Sequence:CCGGGAGTGTCACTGGGCATTTCTACTCGAGTAGAAATGCCCAGTGACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032793.2-1965s1c1
Sequence:CCGGCCACTGTGAATATGCCAAGGACTCGAGTCCTTGGCATATTCACAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032793.2-819s1c1
Sequence:CCGGGCTTCACAAAGTGCCAACCATCTCGAGATGGTTGGCACTTTGTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032793.3-1392s21c1
Sequence:CCGGCCATGCTGCCTGATGTCATTGCTCGAGCAATGACATCAGGCAGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032793.3-1187s21c1
Sequence:CCGGATCATGCTCTCGGCCACTTTACTCGAGTAAAGTGGCCGAGAGCATGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032793.3-1566s21c1
Sequence:CCGGAGCCGGAACGTGTCAAGTTTACTCGAGTAAACTTGACACGTTCCGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032793
MFSD2A MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 2A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032793.2-1283s1c1
Sequence:CCGGCATGGAGAGTAACCTCATCATCTCGAGATGATGAGGTTACTCTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140378    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032793.2-1999s1c1
Sequence:CCGGGCCCGGAACACTAATGTAGAACTCGAGTTCTACATTAGTGTTCCGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032793.2-1026s1c1
Sequence:CCGGCACGGCCCATACATCAAACTTCTCGAGAAGTTTGATGTATGGGCCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032793.2-1474s1c1
Sequence:CCGGGAGTGTCACTGGGCATTTCTACTCGAGTAGAAATGCCCAGTGACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032793.2-1965s1c1
Sequence:CCGGCCACTGTGAATATGCCAAGGACTCGAGTCCTTGGCATATTCACAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032793.2-819s1c1
Sequence:CCGGGCTTCACAAAGTGCCAACCATCTCGAGATGGTTGGCACTTTGTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032793.3-1392s21c1
Sequence:CCGGCCATGCTGCCTGATGTCATTGCTCGAGCAATGACATCAGGCAGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032793.3-1187s21c1
Sequence:CCGGATCATGCTCTCGGCCACTTTACTCGAGTAAAGTGGCCGAGAGCATGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032793.3-1566s21c1
Sequence:CCGGAGCCGGAACGTGTCAAGTTTACTCGAGTAAACTTGACACGTTCCGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029662
MFSD2A MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 2A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029662.1-1283s1c1
Sequence:CCGGGCGTAATCTAATCGTCACTTACTCGAGTAAGTGACGATTAGATTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029662.1-739s1c1
Sequence:CCGGGCACAGCGATTCAAGGACAAACTCGAGTTTGTCCTTGAATCGCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029662.1-519s1c1
Sequence:CCGGGCTTACTTCCTCATCTGGTTTCTCGAGAAACCAGATGAGGAAGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029662.1-975s1c1
Sequence:CCGGGCTGAGTCAATGCCCTTCTTTCTCGAGAAAGAAGGGCATTGACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029662.1-1998s1c1
Sequence:CCGGGCTCGGAACACTAATGTAGAACTCGAGTTCTACATTAGTGTTCCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029662
MFSD2A MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 2A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029662.1-1283s1c1
Sequence:CCGGGCGTAATCTAATCGTCACTTACTCGAGTAAGTGACGATTAGATTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029662.1-739s1c1
Sequence:CCGGGCACAGCGATTCAAGGACAAACTCGAGTTTGTCCTTGAATCGCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029662.1-519s1c1
Sequence:CCGGGCTTACTTCCTCATCTGGTTTCTCGAGAAACCAGATGAGGAAGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029662.1-975s1c1
Sequence:CCGGGCTGAGTCAATGCCCTTCTTTCTCGAGAAAGAAGGGCATTGACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029662.1-1998s1c1
Sequence:CCGGGCTCGGAACACTAATGTAGAACTCGAGTTCTACATTAGTGTTCCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029662
MFSD2A MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 2A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029662.1-1283s1c1
Sequence:CCGGGCGTAATCTAATCGTCACTTACTCGAGTAAGTGACGATTAGATTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029662.1-739s1c1
Sequence:CCGGGCACAGCGATTCAAGGACAAACTCGAGTTTGTCCTTGAATCGCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029662.1-519s1c1
Sequence:CCGGGCTTACTTCCTCATCTGGTTTCTCGAGAAACCAGATGAGGAAGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029662.1-975s1c1
Sequence:CCGGGCTGAGTCAATGCCCTTCTTTCTCGAGAAAGAAGGGCATTGACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029662.1-1998s1c1
Sequence:CCGGGCTCGGAACACTAATGTAGAACTCGAGTTCTACATTAGTGTTCCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)