EMAIL THIS PAGE TO A FRIEND

MFSD2B

major facilitator superfamily domain containing 2B

70 Gene Product Result for
UniProtKB ID: A6NFX1, B5MC32
Gene ID:
Mouse(432628) major facilitator superfamily domain containing 2B
Rat(500624) major facilitator superfamily domain containing 2B
chicken(428656) major facilitator superfamily domain containing 2B
dog(610803) major facilitator superfamily domain containing 2B
domestic cat(101097887) major facilitator superfamily domain containing 2B
cow(539221) major facilitator superfamily domain containing 2B
sheep(101107855) major facilitator superfamily domain containing 2B
domestic guinea pig(100718129) major facilitator superfamily domain containing 2B
naked mole-rat(101725096) major facilitator superfamily domain containing 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033488 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033488 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033488 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080473 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080473 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080473 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU185511 MISSION® esiRNA esiRNA targeting mouse Mfsd2b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080473 Rosetta Predictions human pricing
XM_371481 Rosetta Predictions human pricing
XM_575999 Rosetta Predictions rat pricing
XR_008727 Rosetta Predictions rat pricing
NM_001033488 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315176 predicted 681
2 SASI_Hs02_00315177 predicted 1133
3 SASI_Hs02_00315178 predicted 384
4 SASI_Hs02_00315179 predicted 1058
5 SASI_Hs02_00315180 predicted 1071
6 SASI_Hs02_00315181 predicted 736
7 SASI_Hs02_00315182 predicted 846
8 SASI_Hs02_00315183 predicted 1194
9 SASI_Hs02_00315184 predicted 601
10 SASI_Hs02_00315185 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292591 predicted 683
2 SASI_Hs01_00292592 predicted 1135
3 SASI_Hs01_00292593 predicted 384
4 SASI_Hs01_00292594 predicted 1054
5 SASI_Hs01_00292595 predicted 1064
6 SASI_Hs01_00292596 predicted 734
7 SASI_Hs01_00292597 predicted 851
8 SASI_Hs01_00292598 predicted 1193
9 SASI_Hs01_00292599 predicted 1241
10 SASI_Hs01_00292600 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00181274 predicted 253
2 SASI_Rn01_00181275 predicted 250
3 SASI_Rn01_00181276 predicted 256
4 SASI_Rn01_00181277 predicted 260
5 SASI_Rn01_00181278 predicted 206
6 SASI_Rn01_00181279 predicted 202
7 SASI_Rn01_00181280 predicted 257
8 SASI_Rn01_00181281 predicted 200
9 SASI_Rn01_00181282 predicted 213
10 SASI_Rn01_00181283 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008727 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00164475 predicted 1448
2 SASI_Rn02_00417756 predicted 372
3 SASI_Rn02_00417757 predicted 940
4 SASI_Rn01_00164483 predicted 919
5 SASI_Rn02_00417758 predicted 658
6 SASI_Rn02_00417759 predicted 1390
7 SASI_Rn02_00417760 predicted 1391
8 SASI_Rn02_00417761 predicted 741
9 SASI_Rn02_00417762 predicted 432
10 SASI_Rn02_00417763 predicted 951
11 SASI_Rn01_00164474 predicted 1242
12 SASI_Rn01_00164476 predicted 1229
13 SASI_Rn01_00164477 predicted 1498
14 SASI_Rn01_00164478 predicted 1389
15 SASI_Rn01_00164479 predicted 876
16 SASI_Rn01_00164480 predicted 885
17 SASI_Rn01_00164481 predicted 1579
18 SASI_Rn01_00164482 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066458 predicted 1447
2 SASI_Mm02_00288853 predicted 1098
3 SASI_Mm01_00066459 predicted 921
4 SASI_Mm02_00288854 predicted 667
5 SASI_Mm01_00066462 predicted 921
6 SASI_Mm01_00066463 predicted 366
7 SASI_Mm01_00066464 predicted 942
8 SASI_Mm01_00066465 predicted 939
9 SASI_Mm01_00066466 predicted 664
10 SASI_Mm02_00288855 predicted 1304
11 SASI_Mm01_00066460 predicted 1048
12 SASI_Mm01_00066461 predicted 1373
13 SASI_Mm01_00066467 predicted 1472
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033488
MFSD2B MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 2B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033488.2-1387s21c1
Sequence:CCGGCCACCTGTATGATCCTTATTGCTCGAGCAATAAGGATCATACAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033488.2-699s21c1
Sequence:CCGGGCCGTGGTTGCCTTGACTTATCTCGAGATAAGTCAAGGCAACCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033488.2-1494s21c1
Sequence:CCGGTACAGCCTTGCCTGAACTTTACTCGAGTAAAGTTCAGGCAAGGCTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033488.2-667s21c1
Sequence:CCGGCAGATGTAGCTCGCCTCTATTCTCGAGAATAGAGGCGAGCTACATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033488.2-2455s21c1
Sequence:CCGGCCACCCTGGAAGCCCATTAAACTCGAGTTTAATGGGCTTCCAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033488
MFSD2B MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 2B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033488.2-1387s21c1
Sequence:CCGGCCACCTGTATGATCCTTATTGCTCGAGCAATAAGGATCATACAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033488.2-699s21c1
Sequence:CCGGGCCGTGGTTGCCTTGACTTATCTCGAGATAAGTCAAGGCAACCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033488.2-1494s21c1
Sequence:CCGGTACAGCCTTGCCTGAACTTTACTCGAGTAAAGTTCAGGCAAGGCTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033488.2-667s21c1
Sequence:CCGGCAGATGTAGCTCGCCTCTATTCTCGAGAATAGAGGCGAGCTACATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033488.2-2455s21c1
Sequence:CCGGCCACCCTGGAAGCCCATTAAACTCGAGTTTAATGGGCTTCCAGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033488
MFSD2B MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 2B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033488.2-1387s21c1
Sequence:CCGGCCACCTGTATGATCCTTATTGCTCGAGCAATAAGGATCATACAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033488.2-699s21c1
Sequence:CCGGGCCGTGGTTGCCTTGACTTATCTCGAGATAAGTCAAGGCAACCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033488.2-1494s21c1
Sequence:CCGGTACAGCCTTGCCTGAACTTTACTCGAGTAAAGTTCAGGCAAGGCTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033488.2-667s21c1
Sequence:CCGGCAGATGTAGCTCGCCTCTATTCTCGAGAATAGAGGCGAGCTACATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033488.2-2455s21c1
Sequence:CCGGCCACCCTGGAAGCCCATTAAACTCGAGTTTAATGGGCTTCCAGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080473
MFSD2B MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 2B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080473.1-1195s21c1
Sequence:CCGGCAGACGTGGTGGATGACTTTCCTCGAGGAAAGTCATCCACCACGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080473.1-126s21c1
Sequence:CCGGCGCCTCTCATTCTGTACAAAGCTCGAGCTTTGTACAGAATGAGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080473.1-1053s21c1
Sequence:CCGGACGTCAGCCTTTGGGATCTTTCTCGAGAAAGATCCCAAAGGCTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080473.1-1076s21c1
Sequence:CCGGGATGGTGCCCTTTGCGATCTTCTCGAGAAGATCGCAAAGGGCACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080473.1-1255s21c1
Sequence:CCGGTCTACTCCTCCTACGTCTTCTCTCGAGAGAAGACGTAGGAGGAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080473
MFSD2B MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 2B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080473.1-1195s21c1
Sequence:CCGGCAGACGTGGTGGATGACTTTCCTCGAGGAAAGTCATCCACCACGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080473.1-126s21c1
Sequence:CCGGCGCCTCTCATTCTGTACAAAGCTCGAGCTTTGTACAGAATGAGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080473.1-1053s21c1
Sequence:CCGGACGTCAGCCTTTGGGATCTTTCTCGAGAAAGATCCCAAAGGCTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080473.1-1076s21c1
Sequence:CCGGGATGGTGCCCTTTGCGATCTTCTCGAGAAGATCGCAAAGGGCACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080473.1-1255s21c1
Sequence:CCGGTCTACTCCTCCTACGTCTTCTCTCGAGAGAAGACGTAGGAGGAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080473
MFSD2B MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 2B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080473.1-1195s21c1
Sequence:CCGGCAGACGTGGTGGATGACTTTCCTCGAGGAAAGTCATCCACCACGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080473.1-126s21c1
Sequence:CCGGCGCCTCTCATTCTGTACAAAGCTCGAGCTTTGTACAGAATGAGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080473.1-1053s21c1
Sequence:CCGGACGTCAGCCTTTGGGATCTTTCTCGAGAAAGATCCCAAAGGCTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080473.1-1076s21c1
Sequence:CCGGGATGGTGCCCTTTGCGATCTTCTCGAGAAGATCGCAAAGGGCACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080473.1-1255s21c1
Sequence:CCGGTCTACTCCTCCTACGTCTTCTCTCGAGAGAAGACGTAGGAGGAGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)