EMAIL THIS PAGE TO A FRIEND

MFSD4

major facilitator superfamily domain containing 4

65 Gene Product Result for
Synonyms: UNQ3064
UniProtKB ID: Q8N468, Q6UY25, Q8NAY0, Q8TCP4
Gene ID:
Mouse(213006) major facilitator superfamily domain containing 4
Rat(498228) major facilitator superfamily domain containing 4
chicken(419831) major facilitator superfamily domain containing 4
domestic cat(101086112) major facilitator superfamily domain containing 4
cow(515128) major facilitator superfamily domain containing 4
dog(478943) major facilitator superfamily domain containing 4
sheep(101114541) major facilitator superfamily domain containing 4
domestic guinea pig(100719526) major facilitator superfamily domain containing 4
naked mole-rat(101706203) major facilitator superfamily domain containing 4
Domestic Rabbit(100348417) major facilitator superfamily domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172510 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172510 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172510 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181644 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181644 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181644 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001401 MISSION® esiRNA esiRNA targeting human MFSD4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181644 Rosetta Predictions human pricing
NM_001109069 Rosetta Predictions rat pricing
NM_001114662 Rosetta Predictions mouse pricing
NM_172510 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053765 predicted 1521
2 SASI_Hs01_00053766 predicted 1273
3 SASI_Hs01_00053768 predicted 1853
4 SASI_Hs02_00370216 predicted 752
5 SASI_Hs01_00053769 predicted 1062
6 SASI_Hs01_00053770 predicted 1373
7 SASI_Hs02_00370217 predicted 237
8 SASI_Hs01_00053772 predicted 1193
9 SASI_Hs01_00053773 predicted 1846
10 SASI_Hs01_00053774 predicted 1490
11 SASI_Hs01_00053767 predicted 1675
12 SASI_Hs01_00053771 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109069 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244820 predicted 1490
2 SASI_Rn02_00244821 predicted 1345
3 SASI_Rn02_00244822 predicted 714
4 SASI_Rn02_00244823 predicted 793
5 SASI_Rn02_00244824 predicted 1174
6 SASI_Rn02_00244825 predicted 1739
7 SASI_Rn02_00244826 predicted 1796
8 SASI_Rn02_00244827 predicted 1657
9 SASI_Rn02_00244828 predicted 1633
10 SASI_Rn02_00244829 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114662 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308767 predicted 1282
2 SASI_Mm02_00308768 predicted 466
3 SASI_Mm02_00308769 predicted 659
4 SASI_Mm02_00308770 predicted 1093
5 SASI_Mm02_00308771 predicted 1122
6 SASI_Mm02_00308772 predicted 1176
7 SASI_Mm02_00308773 predicted 481
8 SASI_Mm02_00308774 predicted 806
9 SASI_Mm02_00308775 predicted 1283
10 SASI_Mm02_00308776 predicted 1132
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344099 predicted 1283
2 SASI_Mm02_00344100 predicted 466
3 SASI_Mm02_00344101 predicted 660
4 SASI_Mm02_00344102 predicted 1089
5 SASI_Mm02_00344103 predicted 1120
6 SASI_Mm02_00344104 predicted 1174
7 SASI_Mm01_00167433 predicted 480
8 SASI_Mm01_00167434 predicted 814
9 SASI_Mm02_00344105 predicted 1283
10 SASI_Mm02_00344106 predicted 1133
11 SASI_Mm01_00167430 predicted 1059
12 SASI_Mm01_00167431 predicted 762
13 SASI_Mm01_00167432 predicted 1373
14 SASI_Mm01_00167435 predicted 1609
15 SASI_Mm01_00167436 predicted 1378
16 SASI_Mm01_00167437 predicted 861
17 SASI_Mm01_00167438 predicted 1555
18 SASI_Mm01_00167439 predicted 700
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172510
MFSD4 MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172510.1-2426s1c1
Sequence:CCGGCCCTCTTCTATACAGAAGGTACTCGAGTACCTTCTGTATAGAAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172510.1-1247s1c1
Sequence:CCGGGCCTGACACTTTAGTTATCTTCTCGAGAAGATAACTAAAGTGTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172510.1-687s1c1
Sequence:CCGGCGTATCCTATGCCTTCTGGATCTCGAGATCCAGAAGGCATAGGATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172510.1-702s1c1
Sequence:CCGGCTGGATCATGGCTCTCATCAACTCGAGTTGATGAGAGCCATGATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172510.4-1434s21c1
Sequence:CCGGGAGGACATCCTCCAGTATAAACTCGAGTTTATACTGGAGGATGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172510.4-2138s21c1
Sequence:CCGGTCTTATCAACAGGTAGCATTACTCGAGTAATGCTACCTGTTGATAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172510.4-1123s21c1
Sequence:CCGGACGGGATGATGGGCGCTTATTCTCGAGAATAAGCGCCCATCATCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172510.4-552s21c1
Sequence:CCGGATGCAGTTGGTGAGGATATACCTCGAGGTATATCCTCACCAACTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172510.4-474s21c1
Sequence:CCGGTGCCATGACGTGAAGGTATTGCTCGAGCAATACCTTCACGTCATGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172510
MFSD4 MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172510.1-2426s1c1
Sequence:CCGGCCCTCTTCTATACAGAAGGTACTCGAGTACCTTCTGTATAGAAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172510.1-1247s1c1
Sequence:CCGGGCCTGACACTTTAGTTATCTTCTCGAGAAGATAACTAAAGTGTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172510.1-687s1c1
Sequence:CCGGCGTATCCTATGCCTTCTGGATCTCGAGATCCAGAAGGCATAGGATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172510.1-702s1c1
Sequence:CCGGCTGGATCATGGCTCTCATCAACTCGAGTTGATGAGAGCCATGATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172510.4-1434s21c1
Sequence:CCGGGAGGACATCCTCCAGTATAAACTCGAGTTTATACTGGAGGATGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172510.4-2138s21c1
Sequence:CCGGTCTTATCAACAGGTAGCATTACTCGAGTAATGCTACCTGTTGATAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172510.4-1123s21c1
Sequence:CCGGACGGGATGATGGGCGCTTATTCTCGAGAATAAGCGCCCATCATCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172510.4-552s21c1
Sequence:CCGGATGCAGTTGGTGAGGATATACCTCGAGGTATATCCTCACCAACTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172510.4-474s21c1
Sequence:CCGGTGCCATGACGTGAAGGTATTGCTCGAGCAATACCTTCACGTCATGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172510
MFSD4 MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172510.1-2426s1c1
Sequence:CCGGCCCTCTTCTATACAGAAGGTACTCGAGTACCTTCTGTATAGAAGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172510.1-1247s1c1
Sequence:CCGGGCCTGACACTTTAGTTATCTTCTCGAGAAGATAACTAAAGTGTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172510.1-687s1c1
Sequence:CCGGCGTATCCTATGCCTTCTGGATCTCGAGATCCAGAAGGCATAGGATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172510.1-702s1c1
Sequence:CCGGCTGGATCATGGCTCTCATCAACTCGAGTTGATGAGAGCCATGATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172510.4-1434s21c1
Sequence:CCGGGAGGACATCCTCCAGTATAAACTCGAGTTTATACTGGAGGATGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172510.4-2138s21c1
Sequence:CCGGTCTTATCAACAGGTAGCATTACTCGAGTAATGCTACCTGTTGATAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172510.4-1123s21c1
Sequence:CCGGACGGGATGATGGGCGCTTATTCTCGAGAATAAGCGCCCATCATCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172510.4-552s21c1
Sequence:CCGGATGCAGTTGGTGAGGATATACCTCGAGGTATATCCTCACCAACTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172510.4-474s21c1
Sequence:CCGGTGCCATGACGTGAAGGTATTGCTCGAGCAATACCTTCACGTCATGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181644
MFSD4 MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000244647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181644.4-1252s21c1
Sequence:CCGGCGTTCCTGGTGCTGCTTATTTCTCGAGAAATAAGCAGCACCAGGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181644.4-1439s21c1
Sequence:CCGGGATGCTGGTTGGTTCGATATTCTCGAGAATATCGAACCAACCAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181644.4-2391s21c1
Sequence:CCGGTTGATGCTCTTGAGGTAATTTCTCGAGAAATTACCTCAAGAGCATCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181644.4-1051s21c1
Sequence:CCGGATGGGTTGACGGGTGCCTATTCTCGAGAATAGGCACCCGTCAACCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181644
MFSD4 MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000244647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181644.4-1252s21c1
Sequence:CCGGCGTTCCTGGTGCTGCTTATTTCTCGAGAAATAAGCAGCACCAGGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181644.4-1439s21c1
Sequence:CCGGGATGCTGGTTGGTTCGATATTCTCGAGAATATCGAACCAACCAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181644.4-2391s21c1
Sequence:CCGGTTGATGCTCTTGAGGTAATTTCTCGAGAAATTACCTCAAGAGCATCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181644.4-1051s21c1
Sequence:CCGGATGGGTTGACGGGTGCCTATTCTCGAGAATAGGCACCCGTCAACCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181644
MFSD4 MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000244647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181644.4-1252s21c1
Sequence:CCGGCGTTCCTGGTGCTGCTTATTTCTCGAGAAATAAGCAGCACCAGGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181644.4-1439s21c1
Sequence:CCGGGATGCTGGTTGGTTCGATATTCTCGAGAATATCGAACCAACCAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181644.4-2391s21c1
Sequence:CCGGTTGATGCTCTTGAGGTAATTTCTCGAGAAATTACCTCAAGAGCATCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181644.4-1051s21c1
Sequence:CCGGATGGGTTGACGGGTGCCTATTCTCGAGAATAGGCACCCGTCAACCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)