EMAIL THIS PAGE TO A FRIEND

MFSD5

major facilitator superfamily domain containing 5

68 Gene Product Result for
UniProtKB ID: Q6N075, G3V1N7, Q6NW04, Q8N7W8, Q8NCK0, Q96IA5
Gene ID:
Mouse(106073) major facilitator superfamily domain containing 5
Rat(315329) major facilitator superfamily domain containing 5
Zebrafish(436986) major facilitator superfamily domain containing 5
chicken(777286) major facilitator superfamily domain containing 5
dog(607891) major facilitator superfamily domain containing 5
domestic cat(101083859) major facilitator superfamily domain containing 5
cow(507921) major facilitator superfamily domain containing 5
naked mole-rat(101722905) major facilitator superfamily domain containing 5
domestic guinea pig(100733537) major facilitator superfamily domain containing 5
sheep(101106154) major facilitator superfamily domain containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134100 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134100 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134100 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032889 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032889 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032889 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032889 Rosetta Predictions human pricing
NM_001126282 Rosetta Predictions rat pricing
XR_008462 Rosetta Predictions rat pricing
NM_134100 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023926 predicted 1402
2 SASI_Hs01_00023927 predicted 305
3 SASI_Hs01_00023930 predicted 308
4 SASI_Hs01_00023933 predicted 537
5 SASI_Hs01_00023928 predicted 410
6 SASI_Hs01_00023929 predicted 400
7 SASI_Hs01_00023931 predicted 1161
8 SASI_Hs01_00023932 predicted 1280
9 SASI_Hs01_00023934 predicted 954
10 SASI_Hs01_00023935 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126282 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253193 predicted 1372
2 SASI_Rn02_00253194 predicted 1252
3 SASI_Rn02_00253195 predicted 1148
4 SASI_Rn02_00253196 predicted 1367
5 SASI_Rn02_00253197 predicted 282
6 SASI_Rn02_00253198 predicted 533
7 SASI_Rn02_00253199 predicted 1097
8 SASI_Rn02_00253200 predicted 451
9 SASI_Rn02_00253201 predicted 1086
10 SASI_Rn02_00253202 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008462 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00168331 predicted 1299
2 SASI_Rn01_00168332 predicted 1176
3 SASI_Rn01_00168333 predicted 1294
4 SASI_Rn01_00168334 predicted 290
5 SASI_Rn01_00168335 predicted 1086
6 SASI_Rn01_00168336 predicted 540
7 SASI_Rn01_00168337 predicted 631
8 SASI_Rn01_00168338 predicted 453
9 SASI_Rn01_00168339 predicted 650
10 SASI_Rn01_00168340 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134100 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339331 predicted 971
2 SASI_Mm01_00178796 predicted 1037
3 SASI_Mm01_00178798 predicted 964
4 SASI_Mm01_00178801 predicted 1034
5 SASI_Mm01_00178802 predicted 963
6 SASI_Mm02_00339332 predicted 1125
7 SASI_Mm02_00339333 predicted 718
8 SASI_Mm02_00339334 predicted 641
9 SASI_Mm02_00339335 predicted 1064
10 SASI_Mm01_00178795 predicted 540
11 SASI_Mm01_00178797 predicted 372
12 SASI_Mm01_00178799 predicted 318
13 SASI_Mm01_00178800 predicted 375
14 SASI_Mm01_00178803 predicted 323
15 SASI_Mm01_00178804 predicted 531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134100
MFSD5 MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134100.4-311s21c1
Sequence:CCGGAGTTTCAACTAGACTTCTATCCTCGAGGATAGAAGTCTAGTTGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134100.3-535s1c1
Sequence:CCGGCTTACTCTCTATGTTGCATAACTCGAGTTATGCAACATAGAGAGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134100.4-950s21c1
Sequence:CCGGGTGTCATACAAGCGCTGTTTGCTCGAGCAAACAGCGCTTGTATGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134100.4-367s21c1
Sequence:CCGGCAAGCTCCCTACCTGTATAAACTCGAGTTTATACAGGTAGGGAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134100.4-533s21c1
Sequence:CCGGCTTACTCTCTATGTTGCATAACTCGAGTTATGCAACATAGAGAGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134100.4-1565s21c1
Sequence:CCGGTGAGATGGGCTCTGGAACACACTCGAGTGTGTTCCAGAGCCCATCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134100.2-325s1c1
Sequence:CCGGGACTTCTATCAAGTCTACTTTCTCGAGAAAGTAGACTTGATAGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134100.2-966s1c1
Sequence:CCGGGCTGTTTGAGAGTGTCATCTTCTCGAGAAGATGACACTCTCAAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134100.2-973s1c1
Sequence:CCGGGAGAGTGTCATCTTTATCTTTCTCGAGAAAGATAAAGATGACACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134100
MFSD5 MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134100.4-311s21c1
Sequence:CCGGAGTTTCAACTAGACTTCTATCCTCGAGGATAGAAGTCTAGTTGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134100.3-535s1c1
Sequence:CCGGCTTACTCTCTATGTTGCATAACTCGAGTTATGCAACATAGAGAGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134100.4-950s21c1
Sequence:CCGGGTGTCATACAAGCGCTGTTTGCTCGAGCAAACAGCGCTTGTATGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134100.4-367s21c1
Sequence:CCGGCAAGCTCCCTACCTGTATAAACTCGAGTTTATACAGGTAGGGAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134100.4-533s21c1
Sequence:CCGGCTTACTCTCTATGTTGCATAACTCGAGTTATGCAACATAGAGAGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134100.4-1565s21c1
Sequence:CCGGTGAGATGGGCTCTGGAACACACTCGAGTGTGTTCCAGAGCCCATCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134100.2-325s1c1
Sequence:CCGGGACTTCTATCAAGTCTACTTTCTCGAGAAAGTAGACTTGATAGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134100.2-966s1c1
Sequence:CCGGGCTGTTTGAGAGTGTCATCTTCTCGAGAAGATGACACTCTCAAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134100.2-973s1c1
Sequence:CCGGGAGAGTGTCATCTTTATCTTTCTCGAGAAAGATAAAGATGACACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134100
MFSD5 MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134100.4-311s21c1
Sequence:CCGGAGTTTCAACTAGACTTCTATCCTCGAGGATAGAAGTCTAGTTGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134100.3-535s1c1
Sequence:CCGGCTTACTCTCTATGTTGCATAACTCGAGTTATGCAACATAGAGAGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134100.4-950s21c1
Sequence:CCGGGTGTCATACAAGCGCTGTTTGCTCGAGCAAACAGCGCTTGTATGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134100.4-367s21c1
Sequence:CCGGCAAGCTCCCTACCTGTATAAACTCGAGTTTATACAGGTAGGGAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134100.4-533s21c1
Sequence:CCGGCTTACTCTCTATGTTGCATAACTCGAGTTATGCAACATAGAGAGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134100.4-1565s21c1
Sequence:CCGGTGAGATGGGCTCTGGAACACACTCGAGTGTGTTCCAGAGCCCATCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134100.2-325s1c1
Sequence:CCGGGACTTCTATCAAGTCTACTTTCTCGAGAAAGTAGACTTGATAGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134100.2-966s1c1
Sequence:CCGGGCTGTTTGAGAGTGTCATCTTCTCGAGAAGATGACACTCTCAAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134100.2-973s1c1
Sequence:CCGGGAGAGTGTCATCTTTATCTTTCTCGAGAAAGATAAAGATGACACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032889
MFSD5 MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 5
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000172364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032889.2-1272s1c1
Sequence:CCGGCATGAGCTTCCTACGGAGAAACTCGAGTTTCTCCGTAGGAAGCTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032889.2-306s1c1
Sequence:CCGGCCTTCGGTTTCAACTGGACTTCTCGAGAAGTCCAGTTGAAACCGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032889
MFSD5 MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 5
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000172364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032889.2-1272s1c1
Sequence:CCGGCATGAGCTTCCTACGGAGAAACTCGAGTTTCTCCGTAGGAAGCTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032889.2-306s1c1
Sequence:CCGGCCTTCGGTTTCAACTGGACTTCTCGAGAAGTCCAGTTGAAACCGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032889
MFSD5 MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 5
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000172364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032889.2-1272s1c1
Sequence:CCGGCATGAGCTTCCTACGGAGAAACTCGAGTTTCTCCGTAGGAAGCTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032889.2-306s1c1
Sequence:CCGGCCTTCGGTTTCAACTGGACTTCTCGAGAAGTCCAGTTGAAACCGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)