EMAIL THIS PAGE TO A FRIEND

MFSD6

major facilitator superfamily domain containing 6

166 Gene Product Result for
Synonyms: MMR2 hMMR2
UniProtKB ID: Q6ZSS7, D3KSZ4, Q86TH2, Q9NXM3
Gene ID:
Mouse(98682) major facilitator superfamily domain containing 6
Rat(301388) major facilitator superfamily domain containing 6
sheep(101110650) major facilitator superfamily domain containing 6
domestic guinea pig(100725257) major facilitator superfamily domain containing 6
naked mole-rat(101721950) major facilitator superfamily domain containing 6
chicken(423978) major facilitator superfamily domain containing 6
domestic cat(101082334) major facilitator superfamily domain containing 6
cow(534463) major facilitator superfamily domain containing 6
dog(488445) major facilitator superfamily domain containing 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017694 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017694 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017694 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133829 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133829 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133829 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017694 Rosetta Predictions human pricing
NM_001106911 Rosetta Predictions rat pricing
NM_133829 Rosetta Predictions mouse pricing
NM_178081 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163225 predicted 2453
2 SASI_Hs01_00163226 predicted 1175
3 SASI_Hs01_00163227 predicted 1479
4 SASI_Hs01_00163228 predicted 1012
5 SASI_Hs01_00163229 predicted 1846
6 SASI_Hs01_00163230 predicted 1879
7 SASI_Hs01_00163231 predicted 1671
8 SASI_Hs02_00350447 predicted 639
9 SASI_Hs02_00350448 predicted 1140
10 SASI_Hs02_00350449 predicted 1029
11 SASI_Hs01_00163232 predicted 768
12 SASI_Hs01_00163233 predicted 711
13 SASI_Hs01_00163234 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106911 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223616 predicted 1558
2 SASI_Rn02_00223617 predicted 2427
3 SASI_Rn02_00223618 predicted 2026
4 SASI_Rn02_00223619 predicted 1939
5 SASI_Rn02_00223620 predicted 1812
6 SASI_Rn02_00223621 predicted 2406
7 SASI_Rn02_00223622 predicted 2015
8 SASI_Rn02_00223623 predicted 1334
9 SASI_Rn02_00223624 predicted 1316
10 SASI_Rn02_00223625 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133829 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338847 predicted 1203
2 SASI_Mm02_00338848 predicted 1053
3 SASI_Mm02_00338849 predicted 528
4 SASI_Mm01_00061558 predicted 1907
5 SASI_Mm01_00061559 predicted 1773
6 SASI_Mm02_00338850 predicted 979
7 SASI_Mm02_00338851 predicted 998
8 SASI_Mm02_00338852 predicted 1227
9 SASI_Mm01_00061560 predicted 1437
10 SASI_Mm02_00338853 predicted 631
11 SASI_Mm01_00061556 predicted 945
12 SASI_Mm01_00061557 predicted 623
13 SASI_Mm01_00061561 predicted 1432
14 SASI_Mm01_00061562 predicted 1389
15 SASI_Mm01_00061563 predicted 820
16 SASI_Mm01_00061564 predicted 914
17 SASI_Mm01_00061565 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178081 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047814 predicted 1211
2 SASI_Mm02_00348551 predicted 1052
3 SASI_Mm02_00348552 predicted 523
4 SASI_Mm01_00047817 predicted 1907
5 SASI_Mm01_00047818 predicted 1766
6 SASI_Mm02_00348553 predicted 974
7 SASI_Mm02_00348554 predicted 1000
8 SASI_Mm01_00047820 predicted 1223
9 SASI_Mm01_00047821 predicted 1435
10 SASI_Mm02_00348555 predicted 629
11 SASI_Mm01_00047815 predicted 1831
12 SASI_Mm01_00047816 predicted 1522
13 SASI_Mm01_00047819 predicted 1109
14 SASI_Mm01_00047822 predicted 1704
15 SASI_Mm01_00047823 predicted 1908
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017694
VALIDATED
MFSD6 MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017694.2-1619s1c1
Sequence:CCGGCGGCTCGCTATATTTATATTTCTCGAGAAATATAAATATAGCGAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017694.3-691s21c1
Sequence:CCGGGTAGTTGCAGACCGCTTTAAACTCGAGTTTAAAGCGGTCTGCAACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017694.3-1092s21c1
Sequence:CCGGCAAGGAGACAACCACTGTTATCTCGAGATAACAGTGGTTGTCTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017694.3-834s21c1
Sequence:CCGGCAATGCAAGTCACCAGTTAACCTCGAGGTTAACTGGTGACTTGCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017694.3-1195s21c1
Sequence:CCGGATCTTGGTAGTTGTCATAATACTCGAGTATTATGACAACTACCAAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017694.2-376s1c1
Sequence:CCGGGTAGGTATTCGTTACTTCATTCTCGAGAATGAAGTAACGAATACCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168041    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_017694.2-2782s1c1
Sequence:CCGGCGAGGTGAATGTGGATATAATCTCGAGATTATATCCACATTCACCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017694.2-124s1c1
Sequence:CCGGGCAGATCCCTTTAATGGTATTCTCGAGAATACCATTAAAGGGATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017694.2-1826s1c1
Sequence:CCGGGAGGCGTGTTAGTCAATTATTCTCGAGAATAATTGACTAACACGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_017694.2-1824s1c1
Sequence:CCGGCGGAGGCGTGTTAGTCAATTACTCGAGTAATTGACTAACACGCCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017694
VALIDATED
MFSD6 MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017694.2-1619s1c1
Sequence:CCGGCGGCTCGCTATATTTATATTTCTCGAGAAATATAAATATAGCGAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017694.3-691s21c1
Sequence:CCGGGTAGTTGCAGACCGCTTTAAACTCGAGTTTAAAGCGGTCTGCAACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017694.3-1092s21c1
Sequence:CCGGCAAGGAGACAACCACTGTTATCTCGAGATAACAGTGGTTGTCTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017694.3-834s21c1
Sequence:CCGGCAATGCAAGTCACCAGTTAACCTCGAGGTTAACTGGTGACTTGCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017694.3-1195s21c1
Sequence:CCGGATCTTGGTAGTTGTCATAATACTCGAGTATTATGACAACTACCAAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017694.2-376s1c1
Sequence:CCGGGTAGGTATTCGTTACTTCATTCTCGAGAATGAAGTAACGAATACCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168041    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_017694.2-2782s1c1
Sequence:CCGGCGAGGTGAATGTGGATATAATCTCGAGATTATATCCACATTCACCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017694.2-124s1c1
Sequence:CCGGGCAGATCCCTTTAATGGTATTCTCGAGAATACCATTAAAGGGATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017694.2-1826s1c1
Sequence:CCGGGAGGCGTGTTAGTCAATTATTCTCGAGAATAATTGACTAACACGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_017694.2-1824s1c1
Sequence:CCGGCGGAGGCGTGTTAGTCAATTACTCGAGTAATTGACTAACACGCCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017694
VALIDATED
MFSD6 MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017694.2-1619s1c1
Sequence:CCGGCGGCTCGCTATATTTATATTTCTCGAGAAATATAAATATAGCGAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017694.3-691s21c1
Sequence:CCGGGTAGTTGCAGACCGCTTTAAACTCGAGTTTAAAGCGGTCTGCAACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017694.3-1092s21c1
Sequence:CCGGCAAGGAGACAACCACTGTTATCTCGAGATAACAGTGGTTGTCTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017694.3-834s21c1
Sequence:CCGGCAATGCAAGTCACCAGTTAACCTCGAGGTTAACTGGTGACTTGCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017694.3-1195s21c1
Sequence:CCGGATCTTGGTAGTTGTCATAATACTCGAGTATTATGACAACTACCAAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017694.2-376s1c1
Sequence:CCGGGTAGGTATTCGTTACTTCATTCTCGAGAATGAAGTAACGAATACCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168041    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_017694.2-2782s1c1
Sequence:CCGGCGAGGTGAATGTGGATATAATCTCGAGATTATATCCACATTCACCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017694.2-124s1c1
Sequence:CCGGGCAGATCCCTTTAATGGTATTCTCGAGAATACCATTAAAGGGATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017694.2-1826s1c1
Sequence:CCGGGAGGCGTGTTAGTCAATTATTCTCGAGAATAATTGACTAACACGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_017694.2-1824s1c1
Sequence:CCGGCGGAGGCGTGTTAGTCAATTACTCGAGTAATTGACTAACACGCCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133829
VALIDATED
MFSD6 MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133829.2-2453s21c1
Sequence:CCGGCTATGCTCTCTACCAAGTTAACTCGAGTTAACTTGGTAGAGAGCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133829.2-1389s1c1
Sequence:CCGGGGAATCGACTATACTCATATACTCGAGTATATGAGTATAGTCGATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133829.2-1911s21c1
Sequence:CCGGTGTAATACAGCTCGCTATATTCTCGAGAATATAGCGAGCTGTATTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133829.2-1389s21c1
Sequence:CCGGGGAATCGACTATACTCATATACTCGAGTATATGAGTATAGTCGATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133829.2-2126s21c1
Sequence:CCGGAGGCGTGTTAGTCAATTATTTCTCGAGAAATAATTGACTAACACGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133829.1-2496s1c1
Sequence:CCGGGCATAGTTCTTTGGGACGCAACTCGAGTTGCGTCCCAAAGAACTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133829.1-638s1c1
Sequence:CCGGCCGCTACAACCACTTCAACAACTCGAGTTGTTGAAGTGGTTGTAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133829.1-569s1c1
Sequence:CCGGCCAGATTGTCTTCATCGTCTTCTCGAGAAGACGATGAAGACAATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133829.2-2453s1c1
Sequence:CCGGCTATGCTCTCTACCAAGTTAACTCGAGTTAACTTGGTAGAGAGCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133829.2-1910s1c1
Sequence:CCGGCTGTAATACAGCTCGCTATATCTCGAGATATAGCGAGCTGTATTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133829
VALIDATED
MFSD6 MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133829.2-2453s21c1
Sequence:CCGGCTATGCTCTCTACCAAGTTAACTCGAGTTAACTTGGTAGAGAGCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133829.2-1389s1c1
Sequence:CCGGGGAATCGACTATACTCATATACTCGAGTATATGAGTATAGTCGATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133829.2-1911s21c1
Sequence:CCGGTGTAATACAGCTCGCTATATTCTCGAGAATATAGCGAGCTGTATTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133829.2-1389s21c1
Sequence:CCGGGGAATCGACTATACTCATATACTCGAGTATATGAGTATAGTCGATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133829.2-2126s21c1
Sequence:CCGGAGGCGTGTTAGTCAATTATTTCTCGAGAAATAATTGACTAACACGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133829.1-2496s1c1
Sequence:CCGGGCATAGTTCTTTGGGACGCAACTCGAGTTGCGTCCCAAAGAACTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133829.1-638s1c1
Sequence:CCGGCCGCTACAACCACTTCAACAACTCGAGTTGTTGAAGTGGTTGTAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133829.1-569s1c1
Sequence:CCGGCCAGATTGTCTTCATCGTCTTCTCGAGAAGACGATGAAGACAATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133829.2-2453s1c1
Sequence:CCGGCTATGCTCTCTACCAAGTTAACTCGAGTTAACTTGGTAGAGAGCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133829.2-1910s1c1
Sequence:CCGGCTGTAATACAGCTCGCTATATCTCGAGATATAGCGAGCTGTATTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133829
VALIDATED
MFSD6 MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133829.2-2453s21c1
Sequence:CCGGCTATGCTCTCTACCAAGTTAACTCGAGTTAACTTGGTAGAGAGCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133829.2-1389s1c1
Sequence:CCGGGGAATCGACTATACTCATATACTCGAGTATATGAGTATAGTCGATTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133829.2-1911s21c1
Sequence:CCGGTGTAATACAGCTCGCTATATTCTCGAGAATATAGCGAGCTGTATTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133829.2-1389s21c1
Sequence:CCGGGGAATCGACTATACTCATATACTCGAGTATATGAGTATAGTCGATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133829.2-2126s21c1
Sequence:CCGGAGGCGTGTTAGTCAATTATTTCTCGAGAAATAATTGACTAACACGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133829.1-2496s1c1
Sequence:CCGGGCATAGTTCTTTGGGACGCAACTCGAGTTGCGTCCCAAAGAACTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133829.1-638s1c1
Sequence:CCGGCCGCTACAACCACTTCAACAACTCGAGTTGTTGAAGTGGTTGTAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133829.1-569s1c1
Sequence:CCGGCCAGATTGTCTTCATCGTCTTCTCGAGAAGACGATGAAGACAATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133829.2-2453s1c1
Sequence:CCGGCTATGCTCTCTACCAAGTTAACTCGAGTTAACTTGGTAGAGAGCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133829.2-1910s1c1
Sequence:CCGGCTGTAATACAGCTCGCTATATCTCGAGATATAGCGAGCTGTATTACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)