EMAIL THIS PAGE TO A FRIEND

MFSD6L

major facilitator superfamily domain containing 6-like

68 Gene Product Result for
UniProtKB ID: Q8IWD5, Q6YL34, Q8NA76
Gene ID:
Mouse(215723) major facilitator superfamily domain containing 6-like
Rat(287414) major facilitator superfamily domain containing 6-like
Zebrafish(445192) major facilitator superfamily domain containing 6-like
dog(489496) major facilitator superfamily domain containing 6-like
domestic cat(101081842) major facilitator superfamily domain containing 6-like
cow(614798) major facilitator superfamily domain containing 6-like
naked mole-rat(101721051) major facilitator superfamily domain containing 6-like
domestic guinea pig(100729243) major facilitator superfamily domain containing 6-like
sheep(101102158) major facilitator superfamily domain containing 6-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152599 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152599 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152599 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146004 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146004 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146004 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005591 MISSION® esiRNA esiRNA targeting human MFSD6L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152599 Rosetta Predictions human pricing
NM_001105787 Rosetta Predictions rat pricing
XM_220584 Rosetta Predictions rat pricing
NM_146004 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192508 predicted 805
2 SASI_Hs01_00192509 predicted 956
3 SASI_Hs02_00366445 predicted 306
4 SASI_Hs01_00192510 predicted 1532
5 SASI_Hs01_00192512 predicted 1620
6 SASI_Hs01_00192513 predicted 726
7 SASI_Hs02_00366446 predicted 583
8 SASI_Hs01_00192514 predicted 1854
9 SASI_Hs01_00192515 predicted 630
10 SASI_Hs01_00192517 predicted 1397
11 SASI_Hs01_00192511 predicted 593
12 SASI_Hs01_00192516 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212526 predicted 791
2 SASI_Rn02_00212527 predicted 1029
3 SASI_Rn02_00212528 predicted 963
4 SASI_Rn02_00212529 predicted 1306
5 SASI_Rn02_00212530 predicted 955
6 SASI_Rn02_00212531 predicted 441
7 SASI_Rn02_00212532 predicted 1738
8 SASI_Rn02_00212533 predicted 1693
9 SASI_Rn02_00212534 predicted 489
10 SASI_Rn02_00212535 predicted 1400
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220584 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184331 predicted 659
2 SASI_Rn01_00184332 predicted 896
3 SASI_Rn01_00184333 predicted 837
4 SASI_Rn01_00184334 predicted 1171
5 SASI_Rn01_00184335 predicted 1282
6 SASI_Rn01_00184336 predicted 818
7 SASI_Rn01_00184337 predicted 310
8 SASI_Rn01_00184338 predicted 652
9 SASI_Rn01_00184339 predicted 1558
10 SASI_Rn01_00184340 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146004 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160049 predicted 739
2 SASI_Mm01_00160050 predicted 466
3 SASI_Mm02_00341542 predicted 1662
4 SASI_Mm01_00160051 predicted 436
5 SASI_Mm01_00160053 predicted 1385
6 SASI_Mm01_00160054 predicted 634
7 SASI_Mm01_00160055 predicted 1700
8 SASI_Mm02_00341543 predicted 931
9 SASI_Mm02_00341544 predicted 1185
10 SASI_Mm01_00160057 predicted 713
11 SASI_Mm01_00160048 predicted 1288
12 SASI_Mm01_00160052 predicted 595
13 SASI_Mm01_00160056 predicted 880
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152599
MFSD6L MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 6-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152599.3-1185s21c1
Sequence:CCGGGAGGTGTGGTCCACTTCTATGCTCGAGCATAGAAGTGGACCACACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152599.3-814s21c1
Sequence:CCGGAGATCATCCCTGGGAAGTTACCTCGAGGTAACTTCCCAGGGATGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152599.3-885s21c1
Sequence:CCGGCCGGGAATCCAGCCAATTTGTCTCGAGACAAATTGGCTGGATTCCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152599.2-629s1c1
Sequence:CCGGGACCGAGAAACTTTCCGTGATCTCGAGATCACGGAAAGTTTCTCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152599.2-1306s1c1
Sequence:CCGGGAACTTTCTGTTCTGGCACATCTCGAGATGTGCCAGAACAGAAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152599.2-1942s1c1
Sequence:CCGGGCAAGGAACGAATGGACTGAACTCGAGTTCAGTCCATTCGTTCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152599.2-1162s1c1
Sequence:CCGGCATTGCCTTTCCCATTCCCATCTCGAGATGGGAATGGGAAAGGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152599.2-1480s1c1
Sequence:CCGGGCTGCTGTACTACTCTTTCCTCTCGAGAGGAAAGAGTAGTACAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152599.2-644s1c1
Sequence:CCGGCGTGATCTGCACGTCTACTTACTCGAGTAAGTAGACGTGCAGATCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152599.2-1404s1c1
Sequence:CCGGCGTTCAAAGCTACATTGCTTACTCGAGTAAGCAATGTAGCTTTGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152599
MFSD6L MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 6-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152599.3-1185s21c1
Sequence:CCGGGAGGTGTGGTCCACTTCTATGCTCGAGCATAGAAGTGGACCACACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152599.3-814s21c1
Sequence:CCGGAGATCATCCCTGGGAAGTTACCTCGAGGTAACTTCCCAGGGATGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152599.3-885s21c1
Sequence:CCGGCCGGGAATCCAGCCAATTTGTCTCGAGACAAATTGGCTGGATTCCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152599.2-629s1c1
Sequence:CCGGGACCGAGAAACTTTCCGTGATCTCGAGATCACGGAAAGTTTCTCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152599.2-1306s1c1
Sequence:CCGGGAACTTTCTGTTCTGGCACATCTCGAGATGTGCCAGAACAGAAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152599.2-1942s1c1
Sequence:CCGGGCAAGGAACGAATGGACTGAACTCGAGTTCAGTCCATTCGTTCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152599.2-1162s1c1
Sequence:CCGGCATTGCCTTTCCCATTCCCATCTCGAGATGGGAATGGGAAAGGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152599.2-1480s1c1
Sequence:CCGGGCTGCTGTACTACTCTTTCCTCTCGAGAGGAAAGAGTAGTACAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152599.2-644s1c1
Sequence:CCGGCGTGATCTGCACGTCTACTTACTCGAGTAAGTAGACGTGCAGATCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152599.2-1404s1c1
Sequence:CCGGCGTTCAAAGCTACATTGCTTACTCGAGTAAGCAATGTAGCTTTGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152599
MFSD6L MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 6-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152599.3-1185s21c1
Sequence:CCGGGAGGTGTGGTCCACTTCTATGCTCGAGCATAGAAGTGGACCACACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152599.3-814s21c1
Sequence:CCGGAGATCATCCCTGGGAAGTTACCTCGAGGTAACTTCCCAGGGATGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152599.3-885s21c1
Sequence:CCGGCCGGGAATCCAGCCAATTTGTCTCGAGACAAATTGGCTGGATTCCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152599.2-629s1c1
Sequence:CCGGGACCGAGAAACTTTCCGTGATCTCGAGATCACGGAAAGTTTCTCGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152599.2-1306s1c1
Sequence:CCGGGAACTTTCTGTTCTGGCACATCTCGAGATGTGCCAGAACAGAAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152599.2-1942s1c1
Sequence:CCGGGCAAGGAACGAATGGACTGAACTCGAGTTCAGTCCATTCGTTCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152599.2-1162s1c1
Sequence:CCGGCATTGCCTTTCCCATTCCCATCTCGAGATGGGAATGGGAAAGGCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152599.2-1480s1c1
Sequence:CCGGGCTGCTGTACTACTCTTTCCTCTCGAGAGGAAAGAGTAGTACAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152599.2-644s1c1
Sequence:CCGGCGTGATCTGCACGTCTACTTACTCGAGTAAGTAGACGTGCAGATCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152599.2-1404s1c1
Sequence:CCGGCGTTCAAAGCTACATTGCTTACTCGAGTAAGCAATGTAGCTTTGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146004
MFSD6L MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 6-like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146004.1-956s1c1
Sequence:CCGGGATTTCGTAGACGCCACTGATCTCGAGATCAGTGGCGTCTACGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146004.1-756s1c1
Sequence:CCGGCCCTGAATCTACTTCCTGGAACTCGAGTTCCAGGAAGTAGATTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146004.1-1459s1c1
Sequence:CCGGGCAGGTGCTTTACTATGCTTTCTCGAGAAAGCATAGTAAAGCACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146004.1-859s1c1
Sequence:CCGGGTGGACTTTCATCCTCTCCTTCTCGAGAAGGAGAGGATGAAAGTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146004.1-929s1c1
Sequence:CCGGGCGGATGACAGTCTTTATGAACTCGAGTTCATAAAGACTGTCATCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146004.1-743s1c1
Sequence:CCGGGTAGGCAATGTTACCCTGAATCTCGAGATTCAGGGTAACATTGCCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146004.1-1774s1c1
Sequence:CCGGGCAGAGGATCAACTACTCAAACTCGAGTTTGAGTAGTTGATCCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146004
MFSD6L MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 6-like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146004.1-956s1c1
Sequence:CCGGGATTTCGTAGACGCCACTGATCTCGAGATCAGTGGCGTCTACGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146004.1-756s1c1
Sequence:CCGGCCCTGAATCTACTTCCTGGAACTCGAGTTCCAGGAAGTAGATTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146004.1-1459s1c1
Sequence:CCGGGCAGGTGCTTTACTATGCTTTCTCGAGAAAGCATAGTAAAGCACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146004.1-859s1c1
Sequence:CCGGGTGGACTTTCATCCTCTCCTTCTCGAGAAGGAGAGGATGAAAGTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146004.1-929s1c1
Sequence:CCGGGCGGATGACAGTCTTTATGAACTCGAGTTCATAAAGACTGTCATCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146004.1-743s1c1
Sequence:CCGGGTAGGCAATGTTACCCTGAATCTCGAGATTCAGGGTAACATTGCCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146004.1-1774s1c1
Sequence:CCGGGCAGAGGATCAACTACTCAAACTCGAGTTTGAGTAGTTGATCCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146004
MFSD6L MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 6-like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146004.1-956s1c1
Sequence:CCGGGATTTCGTAGACGCCACTGATCTCGAGATCAGTGGCGTCTACGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146004.1-756s1c1
Sequence:CCGGCCCTGAATCTACTTCCTGGAACTCGAGTTCCAGGAAGTAGATTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146004.1-1459s1c1
Sequence:CCGGGCAGGTGCTTTACTATGCTTTCTCGAGAAAGCATAGTAAAGCACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146004.1-859s1c1
Sequence:CCGGGTGGACTTTCATCCTCTCCTTCTCGAGAAGGAGAGGATGAAAGTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146004.1-929s1c1
Sequence:CCGGGCGGATGACAGTCTTTATGAACTCGAGTTCATAAAGACTGTCATCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146004.1-743s1c1
Sequence:CCGGGTAGGCAATGTTACCCTGAATCTCGAGATTCAGGGTAACATTGCCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146004.1-1774s1c1
Sequence:CCGGGCAGAGGATCAACTACTCAAACTCGAGTTTGAGTAGTTGATCCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)