EMAIL THIS PAGE TO A FRIEND

MFSD7

major facilitator superfamily domain containing 7

43 Gene Product Result for
UniProtKB ID: Q6UXD7, A8K7J5, Q6XYD4, Q8N6H1, Q9H6H6
Gene ID:
Rat(305625) major facilitator superfamily domain containing 7
sheep(101108230) major facilitator superfamily domain containing 7
domestic guinea pig(100732183) major facilitator superfamily domain containing 7
naked mole-rat(101703582) major facilitator superfamily domain containing 7
Zebrafish(553613) major facilitator superfamily domain containing 7
domestic cat(101096392) major facilitator superfamily domain containing 7
Horse(100051663) major facilitator superfamily domain containing 7
cow(511117) major facilitator superfamily domain containing 7
dog(488870) major facilitator superfamily domain containing 7
chicken(769710) major facilitator superfamily domain containing 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032219 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032219 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032219 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032219 Rosetta Predictions human pricing
NM_001107246 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083250 predicted 791
2 SASI_Hs02_00359515 predicted 1311
3 SASI_Hs01_00083252 predicted 1353
4 SASI_Hs01_00083253 predicted 1291
5 SASI_Hs01_00083254 predicted 210
6 SASI_Hs01_00083255 predicted 993
7 SASI_Hs01_00083256 predicted 829
8 SASI_Hs02_00359516 predicted 914
9 SASI_Hs02_00359517 predicted 200
10 SASI_Hs02_00359518 predicted 243
11 SASI_Hs01_00083251 predicted 1234
12 SASI_Hs01_00083257 predicted 1227
13 SASI_Hs01_00083258 predicted 1044
14 SASI_Hs01_00083259 predicted 1448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226945 predicted 1559
2 SASI_Rn02_00226946 predicted 1208
3 SASI_Rn02_00226947 predicted 996
4 SASI_Rn02_00226948 predicted 1199
5 SASI_Rn02_00226949 predicted 738
6 SASI_Rn02_00226950 predicted 448
7 SASI_Rn02_00226951 predicted 505
8 SASI_Rn02_00226952 predicted 1871
9 SASI_Rn02_00226953 predicted 828
10 SASI_Rn02_00226954 predicted 764
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032219
MFSD7 MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032219.2-781s1c1
Sequence:CCGGCTCATGTGGAACAAGGCCTATCTCGAGATAGGCCTTGTTCCACATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032219.2-1185s1c1
Sequence:CCGGCACAGGCATGATCTTTGTGCTCTCGAGAGCACAAAGATCATGCCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032219.2-628s1c1
Sequence:CCGGGACATTCCGTTAATGCTCGGTCTCGAGACCGAGCATTAACGGAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032219.2-1666s1c1
Sequence:CCGGGTCCAAGCGTCCAGGTTTATTCTCGAGAATAAACCTGGACGCTTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032219.2-1220s1c1
Sequence:CCGGGAATACTCATCATGCTGGCAACTCGAGTTGCCAGCATGATGAGTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032219.2-613s1c1
Sequence:CCGGGTCAAGAAGGGTGAGGACATTCTCGAGAATGTCCTCACCCTTCTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032219.2-634s1c1
Sequence:CCGGCCGTTAATGCTCGGTGTCTATCTCGAGATAGACACCGAGCATTAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032219
MFSD7 MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032219.2-781s1c1
Sequence:CCGGCTCATGTGGAACAAGGCCTATCTCGAGATAGGCCTTGTTCCACATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032219.2-1185s1c1
Sequence:CCGGCACAGGCATGATCTTTGTGCTCTCGAGAGCACAAAGATCATGCCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032219.2-628s1c1
Sequence:CCGGGACATTCCGTTAATGCTCGGTCTCGAGACCGAGCATTAACGGAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032219.2-1666s1c1
Sequence:CCGGGTCCAAGCGTCCAGGTTTATTCTCGAGAATAAACCTGGACGCTTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032219.2-1220s1c1
Sequence:CCGGGAATACTCATCATGCTGGCAACTCGAGTTGCCAGCATGATGAGTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032219.2-613s1c1
Sequence:CCGGGTCAAGAAGGGTGAGGACATTCTCGAGAATGTCCTCACCCTTCTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032219.2-634s1c1
Sequence:CCGGCCGTTAATGCTCGGTGTCTATCTCGAGATAGACACCGAGCATTAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032219
MFSD7 MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032219.2-781s1c1
Sequence:CCGGCTCATGTGGAACAAGGCCTATCTCGAGATAGGCCTTGTTCCACATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032219.2-1185s1c1
Sequence:CCGGCACAGGCATGATCTTTGTGCTCTCGAGAGCACAAAGATCATGCCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032219.2-628s1c1
Sequence:CCGGGACATTCCGTTAATGCTCGGTCTCGAGACCGAGCATTAACGGAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032219.2-1666s1c1
Sequence:CCGGGTCCAAGCGTCCAGGTTTATTCTCGAGAATAAACCTGGACGCTTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032219.2-1220s1c1
Sequence:CCGGGAATACTCATCATGCTGGCAACTCGAGTTGCCAGCATGATGAGTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032219.2-613s1c1
Sequence:CCGGGTCAAGAAGGGTGAGGACATTCTCGAGAATGTCCTCACCCTTCTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032219.2-634s1c1
Sequence:CCGGCCGTTAATGCTCGGTGTCTATCTCGAGATAGACACCGAGCATTAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)