EMAIL THIS PAGE TO A FRIEND

MFSD8

major facilitator superfamily domain containing 8

48 Gene Product Result for
Synonyms: CLN7
UniProtKB ID: Q8NHS3, B2RDM1, Q8N2P3
Gene ID:
Human(256471) Summary: This gene encodes a ubiquitous integral membrane protein that contains a transporter domain and a major facilitator superfamily (MFS) domain. Other members of the major facilitator superfamily transport small solutes through chemiosmotic ion gradients. The substrate transported by this protein is unknown. The protein likely localizes to lysosomal membranes. Mutations in this gene are correlated with a variant form of late infantile-onset neuronal ceroid lipofuscinoses (vLINCL). [provided by RefSeq, Oct 2008]
Mouse(72175) major facilitator superfamily domain containing 8
Rat(361939) major facilitator superfamily domain containing 8
sheep(101121711) major facilitator superfamily domain containing 8
naked mole-rat(101699855) major facilitator superfamily domain containing 8
domestic guinea pig(100724232) major facilitator superfamily domain containing 8
Zebrafish(564342) major facilitator superfamily domain containing 8
dog(476086) major facilitator superfamily domain containing 8
cow(515944) major facilitator superfamily domain containing 8
Horse(100071884) major facilitator superfamily domain containing 8
domestic cat(101084281) major facilitator superfamily domain containing 8
chicken(422498) major facilitator superfamily domain containing 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA044802 Anti-MFSD8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2107128 Anti-MFSD8 antibody produced in rabbit affinity isolated antibody human, guinea pig, horse, rabbit
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028140 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028140 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028140 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152778 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152778 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152778 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152778 Rosetta Predictions human pricing
NM_001047910 Rosetta Predictions rat pricing
NM_028140 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152778 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096544 predicted 1643
2 SASI_Hs01_00096545 predicted 396
3 SASI_Hs01_00096546 predicted 1389
4 SASI_Hs02_00366718 predicted 561
5 SASI_Hs01_00096547 predicted 1657
6 SASI_Hs01_00096548 predicted 1426
7 SASI_Hs01_00096549 predicted 1487
8 SASI_Hs02_00366719 predicted 379
9 SASI_Hs01_00096551 predicted 1149
10 SASI_Hs01_00096552 predicted 1481
11 SASI_Hs01_00096550 predicted 620
12 SASI_Hs01_00096553 predicted 1292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047910 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206715 predicted 1330
2 SASI_Rn02_00206716 predicted 625
3 SASI_Rn02_00206717 predicted 617
4 SASI_Rn02_00206718 predicted 497
5 SASI_Rn02_00206719 predicted 1094
6 SASI_Rn02_00206720 predicted 1114
7 SASI_Rn02_00206721 predicted 480
8 SASI_Rn02_00206722 predicted 1265
9 SASI_Rn02_00206723 predicted 1075
10 SASI_Rn02_00206724 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200075 predicted 640
2 SASI_Mm01_00200076 predicted 1634
3 SASI_Mm01_00200077 predicted 553
4 SASI_Mm01_00200078 predicted 1018
5 SASI_Mm01_00200079 predicted 1414
6 SASI_Mm01_00200080 predicted 530
7 SASI_Mm01_00200081 predicted 621
8 SASI_Mm01_00200082 predicted 421
9 SASI_Mm01_00200083 predicted 211
10 SASI_Mm01_00200084 predicted 433
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028140
MFSD8 MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028140.2-2714s1c1
Sequence:CCGGCCTGGGAGATTAGACTAACATCTCGAGATGTTAGTCTAATCTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028140.2-236s1c1
Sequence:CCGGCCCAAGAGCATTACAAGAGTACTCGAGTACTCTTGTAATGCTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028140.2-876s1c1
Sequence:CCGGACGTCAGTGTAAGAGTGTGAACTCGAGTTCACACTCTTACACTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028140.2-383s1c1
Sequence:CCGGGCTGGGTTATTGCTTCATATACTCGAGTATATGAAGCAATAACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028140.2-877s1c1
Sequence:CCGGCGTCAGTGTAAGAGTGTGAATCTCGAGATTCACACTCTTACACTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028140
MFSD8 MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028140.2-2714s1c1
Sequence:CCGGCCTGGGAGATTAGACTAACATCTCGAGATGTTAGTCTAATCTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028140.2-236s1c1
Sequence:CCGGCCCAAGAGCATTACAAGAGTACTCGAGTACTCTTGTAATGCTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028140.2-876s1c1
Sequence:CCGGACGTCAGTGTAAGAGTGTGAACTCGAGTTCACACTCTTACACTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028140.2-383s1c1
Sequence:CCGGGCTGGGTTATTGCTTCATATACTCGAGTATATGAAGCAATAACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028140.2-877s1c1
Sequence:CCGGCGTCAGTGTAAGAGTGTGAATCTCGAGATTCACACTCTTACACTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028140
MFSD8 MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028140.2-2714s1c1
Sequence:CCGGCCTGGGAGATTAGACTAACATCTCGAGATGTTAGTCTAATCTCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028140.2-236s1c1
Sequence:CCGGCCCAAGAGCATTACAAGAGTACTCGAGTACTCTTGTAATGCTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028140.2-876s1c1
Sequence:CCGGACGTCAGTGTAAGAGTGTGAACTCGAGTTCACACTCTTACACTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028140.2-383s1c1
Sequence:CCGGGCTGGGTTATTGCTTCATATACTCGAGTATATGAAGCAATAACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028140.2-877s1c1
Sequence:CCGGCGTCAGTGTAAGAGTGTGAATCTCGAGATTCACACTCTTACACTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152778
VALIDATED
MFSD8 MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 8
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152778.1-1492s1c1
Sequence:CCGGGCTGGTTAACAGCATCTGGAACTCGAGTTCCAGATGCTGTTAACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152778.1-813s1c1
Sequence:CCGGCTTGCCATACTAAGAGAACATCTCGAGATGTTCTCTTAGTATGGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152778.1-370s1c1
Sequence:CCGGCTTCATATAGTCTTGGCCAAACTCGAGTTTGGCCAAGACTATATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152778.1-1422s1c1
Sequence:CCGGGTCTGCAATCTTATGTCCTATCTCGAGATAGGACATAAGATTGCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_152778.1-1735s1c1
Sequence:CCGGCTAAAGCTCTGCTAGACAATTCTCGAGAATTGTCTAGCAGAGCTTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152231    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152778.1-1691s1c1
Sequence:CCGGCTAAGACTGTGATGGAAACTACTCGAGTAGTTTCCATCACAGTCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_152778.1-385s1c1
Sequence:CCGGGCCAAATGGTAGCTTCACCTACTCGAGTAGGTGAAGCTACCATTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152778.1-586s1c1
Sequence:CCGGGATCATATACTGCTGGTGCTACTCGAGTAGCACCAGCAGTATATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_152778.1-358s1c1
Sequence:CCGGGCTGGGTTATTGCTTCATATACTCGAGTATATGAAGCAATAACCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_152778.1-1690s1c1
Sequence:CCGGGCTAAGACTGTGATGGAAACTCTCGAGAGTTTCCATCACAGTCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152778.1-646s1c1
Sequence:CCGGGCATGTGTCAAGCATTAGGTTCTCGAGAACCTAATGCTTGACACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152778.2-393s21c1
Sequence:CCGGGCTGGGTTATTGCTTCATATACTCGAGTATATGAAGCAATAACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152778.2-262s21c1
Sequence:CCGGGAGCCGATGGAGATCTATTAGCTCGAGCTAATAGATCTCCATCGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152778.2-1725s21c1
Sequence:CCGGGCTAAGACTGTGATGGAAACTCTCGAGAGTTTCCATCACAGTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152778.2-420s21c1
Sequence:CCGGGCCAAATGGTAGCTTCACCTACTCGAGTAGGTGAAGCTACCATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152778
VALIDATED
MFSD8 MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 8
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152778.1-1492s1c1
Sequence:CCGGGCTGGTTAACAGCATCTGGAACTCGAGTTCCAGATGCTGTTAACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152778.1-813s1c1
Sequence:CCGGCTTGCCATACTAAGAGAACATCTCGAGATGTTCTCTTAGTATGGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152778.1-370s1c1
Sequence:CCGGCTTCATATAGTCTTGGCCAAACTCGAGTTTGGCCAAGACTATATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152778.1-1422s1c1
Sequence:CCGGGTCTGCAATCTTATGTCCTATCTCGAGATAGGACATAAGATTGCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_152778.1-1735s1c1
Sequence:CCGGCTAAAGCTCTGCTAGACAATTCTCGAGAATTGTCTAGCAGAGCTTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152231    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152778.1-1691s1c1
Sequence:CCGGCTAAGACTGTGATGGAAACTACTCGAGTAGTTTCCATCACAGTCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_152778.1-385s1c1
Sequence:CCGGGCCAAATGGTAGCTTCACCTACTCGAGTAGGTGAAGCTACCATTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152778.1-586s1c1
Sequence:CCGGGATCATATACTGCTGGTGCTACTCGAGTAGCACCAGCAGTATATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_152778.1-358s1c1
Sequence:CCGGGCTGGGTTATTGCTTCATATACTCGAGTATATGAAGCAATAACCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_152778.1-1690s1c1
Sequence:CCGGGCTAAGACTGTGATGGAAACTCTCGAGAGTTTCCATCACAGTCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152778.1-646s1c1
Sequence:CCGGGCATGTGTCAAGCATTAGGTTCTCGAGAACCTAATGCTTGACACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152778.2-393s21c1
Sequence:CCGGGCTGGGTTATTGCTTCATATACTCGAGTATATGAAGCAATAACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152778.2-262s21c1
Sequence:CCGGGAGCCGATGGAGATCTATTAGCTCGAGCTAATAGATCTCCATCGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152778.2-1725s21c1
Sequence:CCGGGCTAAGACTGTGATGGAAACTCTCGAGAGTTTCCATCACAGTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152778.2-420s21c1
Sequence:CCGGGCCAAATGGTAGCTTCACCTACTCGAGTAGGTGAAGCTACCATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152778
VALIDATED
MFSD8 MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 8
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152778.1-1492s1c1
Sequence:CCGGGCTGGTTAACAGCATCTGGAACTCGAGTTCCAGATGCTGTTAACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152778.1-813s1c1
Sequence:CCGGCTTGCCATACTAAGAGAACATCTCGAGATGTTCTCTTAGTATGGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152778.1-370s1c1
Sequence:CCGGCTTCATATAGTCTTGGCCAAACTCGAGTTTGGCCAAGACTATATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152778.1-1422s1c1
Sequence:CCGGGTCTGCAATCTTATGTCCTATCTCGAGATAGGACATAAGATTGCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_152778.1-1735s1c1
Sequence:CCGGCTAAAGCTCTGCTAGACAATTCTCGAGAATTGTCTAGCAGAGCTTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152231    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152778.1-1691s1c1
Sequence:CCGGCTAAGACTGTGATGGAAACTACTCGAGTAGTTTCCATCACAGTCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_152778.1-385s1c1
Sequence:CCGGGCCAAATGGTAGCTTCACCTACTCGAGTAGGTGAAGCTACCATTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152778.1-586s1c1
Sequence:CCGGGATCATATACTGCTGGTGCTACTCGAGTAGCACCAGCAGTATATGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_152778.1-358s1c1
Sequence:CCGGGCTGGGTTATTGCTTCATATACTCGAGTATATGAAGCAATAACCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_152778.1-1690s1c1
Sequence:CCGGGCTAAGACTGTGATGGAAACTCTCGAGAGTTTCCATCACAGTCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152778.1-646s1c1
Sequence:CCGGGCATGTGTCAAGCATTAGGTTCTCGAGAACCTAATGCTTGACACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152778.2-393s21c1
Sequence:CCGGGCTGGGTTATTGCTTCATATACTCGAGTATATGAAGCAATAACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152778.2-262s21c1
Sequence:CCGGGAGCCGATGGAGATCTATTAGCTCGAGCTAATAGATCTCCATCGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152778.2-1725s21c1
Sequence:CCGGGCTAAGACTGTGATGGAAACTCTCGAGAGTTTCCATCACAGTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152778.2-420s21c1
Sequence:CCGGGCCAAATGGTAGCTTCACCTACTCGAGTAGGTGAAGCTACCATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)