EMAIL THIS PAGE TO A FRIEND

MFSD9

major facilitator superfamily domain containing 9

49 Gene Product Result for
UniProtKB ID: Q8NBP5, Q4ZG89, Q53TU0, Q96GQ4, Q9BRI8
Gene ID:
Mouse(211798) major facilitator superfamily domain containing 9
Rat(316356) major facilitator superfamily domain containing 9
Zebrafish(100150581) major facilitator superfamily domain containing 9
cow(514165) major facilitator superfamily domain containing 9
domestic cat(101084352) major facilitator superfamily domain containing 9
dog(100684142) major facilitator superfamily domain containing 9
chicken(418720) major facilitator superfamily domain containing 9
domestic guinea pig(100727404) major facilitator superfamily domain containing 9
naked mole-rat(101714475) major facilitator superfamily domain containing 9
sheep(101108476) major facilitator superfamily domain containing 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032718 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032718 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032718 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172499 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172499 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172499 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137451 MISSION® esiRNA esiRNA human MFSD9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032718 Rosetta Predictions human pricing
NM_001108215 Rosetta Predictions rat pricing
NM_172499 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062968 predicted 529
2 SASI_Hs02_00360252 predicted 1379
3 SASI_Hs01_00062970 predicted 348
4 SASI_Hs01_00062972 predicted 676
5 SASI_Hs01_00062973 predicted 1424
6 SASI_Hs01_00062974 predicted 489
7 SASI_Hs01_00062975 predicted 425
8 SASI_Hs01_00062976 predicted 614
9 SASI_Hs02_00360253 predicted 1414
10 SASI_Hs01_00062977 predicted 895
11 SASI_Hs01_00062969 predicted 898
12 SASI_Hs01_00062971 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108215 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236454 predicted 734
2 SASI_Rn02_00236455 predicted 1366
3 SASI_Rn02_00236456 predicted 1065
4 SASI_Rn02_00236457 predicted 233
5 SASI_Rn02_00236458 predicted 1518
6 SASI_Rn02_00236459 predicted 572
7 SASI_Rn02_00236460 predicted 522
8 SASI_Rn02_00236461 predicted 1436
9 SASI_Rn02_00236462 predicted 272
10 SASI_Rn02_00236463 predicted 1055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344084 predicted 213
2 SASI_Mm01_00101577 predicted 1349
3 SASI_Mm01_00101579 predicted 363
4 SASI_Mm01_00101580 predicted 1471
5 SASI_Mm01_00101581 predicted 501
6 SASI_Mm01_00101582 predicted 917
7 SASI_Mm01_00101583 predicted 864
8 SASI_Mm01_00101584 predicted 1418
9 SASI_Mm01_00101585 predicted 564
10 SASI_Mm02_00344085 predicted 245
11 SASI_Mm01_00101576 predicted 725
12 SASI_Mm01_00101578 predicted 599
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032718
VALIDATED
MFSD9 MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 9
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032718.3-963s21c1
Sequence:CCGGGTCATGCTGTACTACAGTAACCTCGAGGTTACTGTAGTACAGCATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032718.3-1724s21c1
Sequence:CCGGGTGAGCATATTCAGCGTTTACCTCGAGGTAAACGCTGAATATGCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032718.3-915s21c1
Sequence:CCGGTCCGAAATGTGGGACATATTTCTCGAGAAATATGTCCCACATTTCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032718.3-518s21c1
Sequence:CCGGCATCTCAAGGGCTCTACTTTCCTCGAGGAAAGTAGAGCCCTTGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032718.3-1408s21c1
Sequence:CCGGTGTTAGCCTTAGTGGCCATTTCTCGAGAAATGGCCACTAAGGCTAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032718.3-628s21c1
Sequence:CCGGGTGGCTATCTCACTGAATTAGCTCGAGCTAATTCAGTGAGATAGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032718.3-1933s21c1
Sequence:CCGGACTTGAGTTTCCAGTTAAATTCTCGAGAATTTAACTGGAAACTCAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032718.3-1493s21c1
Sequence:CCGGGATGGATTTGGACAACATAAACTCGAGTTTATGTTGTCCAAATCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032718.2-2073s1c1
Sequence:CCGGGCCAAGAAATCCGTGGTGTTTCTCGAGAAACACCACGGATTTCTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_032718.2-539s1c1
Sequence:CCGGGCCGCTTGTAATCGGACACTTCTCGAGAAGTGTCCGATTACAAGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032718.2-1432s1c1
Sequence:CCGGCTAGTGGTGATGGGAATAGTACTCGAGTACTATTCCCATCACCACTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032718.2-678s1c1
Sequence:CCGGGCTGGTCTCGTTTGGTTCTTTCTCGAGAAAGAACCAAACGAGACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032718.2-429s1c1
Sequence:CCGGGCCACCAATGTGTTTCTGTTTCTCGAGAAACAGAAACACATTGGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032718
VALIDATED
MFSD9 MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 9
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032718.3-963s21c1
Sequence:CCGGGTCATGCTGTACTACAGTAACCTCGAGGTTACTGTAGTACAGCATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032718.3-1724s21c1
Sequence:CCGGGTGAGCATATTCAGCGTTTACCTCGAGGTAAACGCTGAATATGCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032718.3-915s21c1
Sequence:CCGGTCCGAAATGTGGGACATATTTCTCGAGAAATATGTCCCACATTTCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032718.3-518s21c1
Sequence:CCGGCATCTCAAGGGCTCTACTTTCCTCGAGGAAAGTAGAGCCCTTGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032718.3-1408s21c1
Sequence:CCGGTGTTAGCCTTAGTGGCCATTTCTCGAGAAATGGCCACTAAGGCTAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032718.3-628s21c1
Sequence:CCGGGTGGCTATCTCACTGAATTAGCTCGAGCTAATTCAGTGAGATAGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032718.3-1933s21c1
Sequence:CCGGACTTGAGTTTCCAGTTAAATTCTCGAGAATTTAACTGGAAACTCAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032718.3-1493s21c1
Sequence:CCGGGATGGATTTGGACAACATAAACTCGAGTTTATGTTGTCCAAATCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032718.2-2073s1c1
Sequence:CCGGGCCAAGAAATCCGTGGTGTTTCTCGAGAAACACCACGGATTTCTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_032718.2-539s1c1
Sequence:CCGGGCCGCTTGTAATCGGACACTTCTCGAGAAGTGTCCGATTACAAGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032718.2-1432s1c1
Sequence:CCGGCTAGTGGTGATGGGAATAGTACTCGAGTACTATTCCCATCACCACTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032718.2-678s1c1
Sequence:CCGGGCTGGTCTCGTTTGGTTCTTTCTCGAGAAAGAACCAAACGAGACCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032718.2-429s1c1
Sequence:CCGGGCCACCAATGTGTTTCTGTTTCTCGAGAAACAGAAACACATTGGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032718
VALIDATED
MFSD9 MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 9
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032718.3-963s21c1
Sequence:CCGGGTCATGCTGTACTACAGTAACCTCGAGGTTACTGTAGTACAGCATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032718.3-1724s21c1
Sequence:CCGGGTGAGCATATTCAGCGTTTACCTCGAGGTAAACGCTGAATATGCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032718.3-915s21c1
Sequence:CCGGTCCGAAATGTGGGACATATTTCTCGAGAAATATGTCCCACATTTCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032718.3-518s21c1
Sequence:CCGGCATCTCAAGGGCTCTACTTTCCTCGAGGAAAGTAGAGCCCTTGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032718.3-1408s21c1
Sequence:CCGGTGTTAGCCTTAGTGGCCATTTCTCGAGAAATGGCCACTAAGGCTAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032718.3-628s21c1
Sequence:CCGGGTGGCTATCTCACTGAATTAGCTCGAGCTAATTCAGTGAGATAGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032718.3-1933s21c1
Sequence:CCGGACTTGAGTTTCCAGTTAAATTCTCGAGAATTTAACTGGAAACTCAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032718.3-1493s21c1
Sequence:CCGGGATGGATTTGGACAACATAAACTCGAGTTTATGTTGTCCAAATCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032718.2-2073s1c1
Sequence:CCGGGCCAAGAAATCCGTGGTGTTTCTCGAGAAACACCACGGATTTCTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_032718.2-539s1c1
Sequence:CCGGGCCGCTTGTAATCGGACACTTCTCGAGAAGTGTCCGATTACAAGCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032718.2-1432s1c1
Sequence:CCGGCTAGTGGTGATGGGAATAGTACTCGAGTACTATTCCCATCACCACTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032718.2-678s1c1
Sequence:CCGGGCTGGTCTCGTTTGGTTCTTTCTCGAGAAAGAACCAAACGAGACCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032718.2-429s1c1
Sequence:CCGGGCCACCAATGTGTTTCTGTTTCTCGAGAAACAGAAACACATTGGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172499
MFSD9 MISSION shRNA Bacterial Glycerol Stock
major facilitator superfamily domain containing 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172499.1-1815s1c1
Sequence:CCGGCCAAGAAGTTTCTCTGCCCAACTCGAGTTGGGCAGAGAAACTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172499.1-163s1c1
Sequence:CCGGGTAGGCTTCTTGGACCTGTTTCTCGAGAAACAGGTCCAAGAAGCCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172499.1-912s1c1
Sequence:CCGGCATGCTGTACTACAGTAACTTCTCGAGAAGTTACTGTAGTACAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172499.1-909s1c1
Sequence:CCGGCGTCATGCTGTACTACAGTAACTCGAGTTACTGTAGTACAGCATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172499.1-395s1c1
Sequence:CCGGCCACCAATGTGTTCCTGTTTACTCGAGTAAACAGGAACACATTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172499
MFSD9 MISSION shRNA shRNA Plasmid DNA
major facilitator superfamily domain containing 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172499.1-1815s1c1
Sequence:CCGGCCAAGAAGTTTCTCTGCCCAACTCGAGTTGGGCAGAGAAACTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172499.1-163s1c1
Sequence:CCGGGTAGGCTTCTTGGACCTGTTTCTCGAGAAACAGGTCCAAGAAGCCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172499.1-912s1c1
Sequence:CCGGCATGCTGTACTACAGTAACTTCTCGAGAAGTTACTGTAGTACAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172499.1-909s1c1
Sequence:CCGGCGTCATGCTGTACTACAGTAACTCGAGTTACTGTAGTACAGCATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172499.1-395s1c1
Sequence:CCGGCCACCAATGTGTTCCTGTTTACTCGAGTAAACAGGAACACATTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172499
MFSD9 MISSION shRNA Lentiviral Transduction Particles
major facilitator superfamily domain containing 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172499.1-1815s1c1
Sequence:CCGGCCAAGAAGTTTCTCTGCCCAACTCGAGTTGGGCAGAGAAACTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172499.1-163s1c1
Sequence:CCGGGTAGGCTTCTTGGACCTGTTTCTCGAGAAACAGGTCCAAGAAGCCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172499.1-912s1c1
Sequence:CCGGCATGCTGTACTACAGTAACTTCTCGAGAAGTTACTGTAGTACAGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172499.1-909s1c1
Sequence:CCGGCGTCATGCTGTACTACAGTAACTCGAGTTACTGTAGTACAGCATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172499.1-395s1c1
Sequence:CCGGCCACCAATGTGTTCCTGTTTACTCGAGTAAACAGGAACACATTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)