EMAIL THIS PAGE TO A FRIEND

MGA

MGA, MAX dimerization protein

288 Gene Product Result for
Synonyms: MAD5 MXD5
Gene ID:
Mouse(29808) MAX gene associated
Rat(499874) MGA, MAX dimerization protein
chicken(423220) MAX gene associated
domestic cat(101084202) MAX gene associated
Horse(100056831) MAX gene associated
cow(532556) MAX gene associated
dog(478266) MAX gene associated
Domestic Rabbit(100342567) MAX gene associated
naked mole-rat(101701209) MGA, MAX dimerization protein
domestic guinea pig(100720731) MGA, MAX dimerization protein
sheep(101114361) MGA, MAX dimerization protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013720 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013720 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013720 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080541 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080541 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080541 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU095091 MISSION® esiRNA esiRNA human MGA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080541 Rosetta Predictions human pricing
XM_031689 Rosetta Predictions human pricing
XM_932720 Rosetta Predictions human pricing
XM_932722 Rosetta Predictions human pricing
XM_932727 Rosetta Predictions human pricing
XM_575215 Rosetta Predictions rat pricing
XR_009414 Rosetta Predictions rat pricing
NM_013720 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315828 predicted 4609
2 SASI_Hs02_00315829 predicted 6759
3 SASI_Hs02_00315830 predicted 2339
4 SASI_Hs02_00315831 predicted 7563
5 SASI_Hs02_00315832 predicted 1937
6 SASI_Hs02_00315833 predicted 5731
7 SASI_Hs02_00315834 predicted 5172
8 SASI_Hs02_00315835 predicted 5588
9 SASI_Hs02_00315836 predicted 8405
10 SASI_Hs02_00315837 predicted 4594
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_031689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270086 predicted 4076
2 SASI_Hs01_00270087 predicted 5932
3 SASI_Hs01_00270088 predicted 2838
4 SASI_Hs01_00270089 predicted 4674
5 SASI_Hs01_00270090 predicted 6745
6 SASI_Hs01_00270091 predicted 451
7 SASI_Hs01_00270092 predicted 1154
8 SASI_Hs01_00270093 predicted 1891
9 SASI_Hs01_00270094 predicted 2982
10 SASI_Hs01_00270095 predicted 4912
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248471 predicted 4120
2 SASI_Hs01_00248472 predicted 5979
3 SASI_Hs01_00248473 predicted 2890
4 SASI_Hs01_00248474 predicted 4715
5 SASI_Hs01_00248475 predicted 6788
6 SASI_Hs01_00248476 predicted 497
7 SASI_Hs01_00248477 predicted 1196
8 SASI_Hs01_00248478 predicted 1938
9 SASI_Hs01_00248479 predicted 3030
10 SASI_Hs01_00248480 predicted 4959
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00262229 predicted 1001
2 SASI_Hs01_00262230 predicted 1477
3 SASI_Hs01_00262231 predicted 1710
4 SASI_Hs01_00262232 predicted 1306
5 SASI_Hs01_00262233 predicted 1213
6 SASI_Hs01_00262234 predicted 1824
7 SASI_Hs01_00262235 predicted 807
8 SASI_Hs01_00262236 predicted 1049
9 SASI_Hs01_00262237 predicted 2288
10 SASI_Hs01_00262238 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279098 predicted 1280
2 SASI_Hs01_00279099 predicted 2793
3 SASI_Hs01_00279100 predicted 2004
4 SASI_Hs01_00279101 predicted 1557
5 SASI_Hs01_00279102 predicted 1195
6 SASI_Hs01_00279103 predicted 2819
7 SASI_Hs01_00279104 predicted 1365
8 SASI_Hs01_00279105 predicted 1571
9 SASI_Hs01_00279106 predicted 978
10 SASI_Hs01_00279107 predicted 3377
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575215 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403307 predicted 703
2 SASI_Rn02_00403308 predicted 524
3 SASI_Rn02_00403309 predicted 747
4 SASI_Rn02_00403310 predicted 884
5 SASI_Rn02_00403311 predicted 749
6 SASI_Rn02_00403312 predicted 245
7 SASI_Rn02_00403313 predicted 514
8 SASI_Rn02_00403314 predicted 437
9 SASI_Rn02_00403315 predicted 1019
10 SASI_Rn02_00403316 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009414 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00419641 predicted 1405
2 SASI_Rn01_00167382 predicted 1450
3 SASI_Rn02_00419642 predicted 751
4 SASI_Rn02_00419643 predicted 2107
5 SASI_Rn02_00419644 predicted 1267
6 SASI_Rn02_00419645 predicted 1297
7 SASI_Rn01_00167387 predicted 514
8 SASI_Rn01_00167388 predicted 434
9 SASI_Rn02_00419646 predicted 1021
10 SASI_Rn02_00419647 predicted 559
11 SASI_Rn01_00167380 predicted 7234
12 SASI_Rn01_00167381 predicted 5058
13 SASI_Rn01_00167383 predicted 7309
14 SASI_Rn01_00167384 predicted 4586
15 SASI_Rn01_00167385 predicted 10189
16 SASI_Rn01_00167386 predicted 10877
17 SASI_Rn01_00167389 predicted 5443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065484 predicted 2839
2 SASI_Mm01_00065486 predicted 2323
3 SASI_Mm02_00322635 predicted 1014
4 SASI_Mm01_00065487 predicted 4085
5 SASI_Mm02_00322636 predicted 754
6 SASI_Mm01_00065489 predicted 439
7 SASI_Mm01_00065492 predicted 6280
8 SASI_Mm02_00322637 predicted 1977
9 SASI_Mm01_00065493 predicted 8125
10 SASI_Mm02_00322638 predicted 515
11 SASI_Mm01_00065485 predicted 7011
12 SASI_Mm01_00065488 predicted 1271
13 SASI_Mm01_00065490 predicted 565
14 SASI_Mm01_00065491 predicted 8607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013720
MGA MISSION shRNA Bacterial Glycerol Stock
MGA, MAX dimerization protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013720.1-2828s1c1
Sequence:CCGGCCTCAGATAATCAGGTGACTACTCGAGTAGTCACCTGATTATCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013720.2-10011s21c1
Sequence:CCGGTTACCCTTTCAGTCATAATTACTCGAGTAATTATGACTGAAAGGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013720.1-3712s1c1
Sequence:CCGGCGAGTATATGAACGAAAGAAACTCGAGTTTCTTTCGTTCATATACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013720.1-827s1c1
Sequence:CCGGGCTCCGATCAAGAAGGGAATACTCGAGTATTCCCTTCTTGATCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013720.1-4194s1c1
Sequence:CCGGCCAAGATGATATGGCTGAGAACTCGAGTTCTCAGCCATATCATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013720.1-8041s1c1
Sequence:CCGGGCACAGGAATTTATACCTAAACTCGAGTTTAGGTATAAATTCCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013720.2-3486s21c1
Sequence:CCGGTGCTAATCGAGATCCATTATTCTCGAGAATAATGGATCTCGATTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013720.2-8374s21c1
Sequence:CCGGGTGAGAGGGCATCGGTATAAACTCGAGTTTATACCGATGCCCTCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013720.2-3674s21c1
Sequence:CCGGTAGATCCAGAGCCGGTTTATACTCGAGTATAAACCGGCTCTGGATCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013720.2-3734s21c1
Sequence:CCGGTGTTGCCTCAGCCGGATTTATCTCGAGATAAATCCGGCTGAGGCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013720
MGA MISSION shRNA shRNA Plasmid DNA
MGA, MAX dimerization protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013720.1-2828s1c1
Sequence:CCGGCCTCAGATAATCAGGTGACTACTCGAGTAGTCACCTGATTATCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013720.2-10011s21c1
Sequence:CCGGTTACCCTTTCAGTCATAATTACTCGAGTAATTATGACTGAAAGGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013720.1-3712s1c1
Sequence:CCGGCGAGTATATGAACGAAAGAAACTCGAGTTTCTTTCGTTCATATACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013720.1-827s1c1
Sequence:CCGGGCTCCGATCAAGAAGGGAATACTCGAGTATTCCCTTCTTGATCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013720.1-4194s1c1
Sequence:CCGGCCAAGATGATATGGCTGAGAACTCGAGTTCTCAGCCATATCATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013720.1-8041s1c1
Sequence:CCGGGCACAGGAATTTATACCTAAACTCGAGTTTAGGTATAAATTCCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013720.2-3486s21c1
Sequence:CCGGTGCTAATCGAGATCCATTATTCTCGAGAATAATGGATCTCGATTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013720.2-8374s21c1
Sequence:CCGGGTGAGAGGGCATCGGTATAAACTCGAGTTTATACCGATGCCCTCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013720.2-3674s21c1
Sequence:CCGGTAGATCCAGAGCCGGTTTATACTCGAGTATAAACCGGCTCTGGATCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013720.2-3734s21c1
Sequence:CCGGTGTTGCCTCAGCCGGATTTATCTCGAGATAAATCCGGCTGAGGCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013720
MGA MISSION shRNA Lentiviral Transduction Particles
MGA, MAX dimerization protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013720.1-2828s1c1
Sequence:CCGGCCTCAGATAATCAGGTGACTACTCGAGTAGTCACCTGATTATCTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013720.2-10011s21c1
Sequence:CCGGTTACCCTTTCAGTCATAATTACTCGAGTAATTATGACTGAAAGGGTAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013720.1-3712s1c1
Sequence:CCGGCGAGTATATGAACGAAAGAAACTCGAGTTTCTTTCGTTCATATACTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013720.1-827s1c1
Sequence:CCGGGCTCCGATCAAGAAGGGAATACTCGAGTATTCCCTTCTTGATCGGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013720.1-4194s1c1
Sequence:CCGGCCAAGATGATATGGCTGAGAACTCGAGTTCTCAGCCATATCATCTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013720.1-8041s1c1
Sequence:CCGGGCACAGGAATTTATACCTAAACTCGAGTTTAGGTATAAATTCCTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013720.2-3486s21c1
Sequence:CCGGTGCTAATCGAGATCCATTATTCTCGAGAATAATGGATCTCGATTAGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013720.2-8374s21c1
Sequence:CCGGGTGAGAGGGCATCGGTATAAACTCGAGTTTATACCGATGCCCTCTCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013720.2-3674s21c1
Sequence:CCGGTAGATCCAGAGCCGGTTTATACTCGAGTATAAACCGGCTCTGGATCTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013720.2-3734s21c1
Sequence:CCGGTGTTGCCTCAGCCGGATTTATCTCGAGATAAATCCGGCTGAGGCAACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080541
VALIDATED
MGA MISSION shRNA Bacterial Glycerol Stock
MGA, MAX dimerization protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000237941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080541.1-3996s21c1
Sequence:CCGGCTAGCCCTGAGAACCATAATACTCGAGTATTATGGTTCTCAGGGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080541.1-9466s21c1
Sequence:CCGGGGCACCTGTTGTGGCTAAATTCTCGAGAATTTAGCCACAACAGGTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080541.1-11390s21c1
Sequence:CCGGTATAGCAGTTTCCCGTTATTTCTCGAGAAATAACGGGAAACTGCTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080541.1-2753s21c1
Sequence:CCGGCCCACTAAGAGTACCAGTTATCTCGAGATAACTGGTACTCTTAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080541.1-3640s21c1
Sequence:CCGGTGTTCGACATTACCCATTATGCTCGAGCATAATGGGTAATGTCGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080541
VALIDATED
MGA MISSION shRNA shRNA Plasmid DNA
MGA, MAX dimerization protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000237941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080541.1-3996s21c1
Sequence:CCGGCTAGCCCTGAGAACCATAATACTCGAGTATTATGGTTCTCAGGGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080541.1-9466s21c1
Sequence:CCGGGGCACCTGTTGTGGCTAAATTCTCGAGAATTTAGCCACAACAGGTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080541.1-11390s21c1
Sequence:CCGGTATAGCAGTTTCCCGTTATTTCTCGAGAAATAACGGGAAACTGCTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080541.1-2753s21c1
Sequence:CCGGCCCACTAAGAGTACCAGTTATCTCGAGATAACTGGTACTCTTAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080541.1-3640s21c1
Sequence:CCGGTGTTCGACATTACCCATTATGCTCGAGCATAATGGGTAATGTCGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080541
VALIDATED
MGA MISSION shRNA Lentiviral Transduction Particles
MGA, MAX dimerization protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000237941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080541.1-3996s21c1
Sequence:CCGGCTAGCCCTGAGAACCATAATACTCGAGTATTATGGTTCTCAGGGCTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080541.1-9466s21c1
Sequence:CCGGGGCACCTGTTGTGGCTAAATTCTCGAGAATTTAGCCACAACAGGTGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080541.1-11390s21c1
Sequence:CCGGTATAGCAGTTTCCCGTTATTTCTCGAGAAATAACGGGAAACTGCTATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080541.1-2753s21c1
Sequence:CCGGCCCACTAAGAGTACCAGTTATCTCGAGATAACTGGTACTCTTAGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080541.1-3640s21c1
Sequence:CCGGTGTTCGACATTACCCATTATGCTCGAGCATAATGGGTAATGTCGAACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)