EMAIL THIS PAGE TO A FRIEND

MGAM

maltase-glucoamylase (alpha-glucosidase)

91 Gene Product Result for
Synonyms: MG MGA
UniProtKB ID: O43451, Q0VAX6, Q75ME7, Q86UM5
Gene ID:
Human(8972) Summary: This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
Mouse(232714) maltase-glucoamylase
Rat(312272) maltase-glucoamylase
chicken(425545) maltase-glucoamylase (alpha-glucosidase)
Horse(100064486) maltase-glucoamylase (alpha-glucosidase)
dog(475523) maltase-glucoamylase (alpha-glucosidase)
cow(100336421) maltase-glucoamylase (alpha-glucosidase)
domestic guinea pig(100714969) maltase-glucoamylase (alpha-glucosidase)
naked mole-rat(101711183) maltase-glucoamylase (alpha-glucosidase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004668 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004668 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004668 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051581 MISSION® esiRNA esiRNA human MGAM (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004668 Rosetta Predictions human pricing
XM_231714 Rosetta Predictions rat pricing
XM_001481277 Rosetta Predictions mouse pricing
XM_001481314 Rosetta Predictions mouse pricing
XM_976153 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139811 predicted 590
2 SASI_Hs02_00338090 predicted 5633
3 SASI_Hs01_00139812 predicted 4677
4 SASI_Hs02_00338091 predicted 1466
5 SASI_Hs01_00139814 predicted 4311
6 SASI_Hs02_00338092 predicted 4902
7 SASI_Hs01_00139816 predicted 2957
8 SASI_Hs01_00139818 predicted 976
9 SASI_Hs01_00139819 predicted 867
10 SASI_Hs02_00338093 predicted 3816
11 SASI_Hs01_00139810 predicted 3303
12 SASI_Hs01_00139813 predicted 3406
13 SASI_Hs01_00139815 predicted 3112
14 SASI_Hs01_00139817 predicted 3535
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231714 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386891 predicted 1708
2 SASI_Rn02_00386892 predicted 4262
3 SASI_Rn02_00386893 predicted 2987
4 SASI_Rn02_00386894 predicted 2114
5 SASI_Rn02_00386895 predicted 4191
6 SASI_Rn02_00386896 predicted 1151
7 SASI_Rn02_00386897 predicted 1373
8 SASI_Rn02_00386898 predicted 996
9 SASI_Rn02_00386899 predicted 2008
10 SASI_Rn02_00386900 predicted 2330
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481277 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423346 predicted 8296
2 SASI_Mm02_00423347 predicted 10792
3 SASI_Mm02_00423348 predicted 1294
4 SASI_Mm02_00423349 predicted 6590
5 SASI_Mm02_00423350 predicted 5119
6 SASI_Mm02_00423351 predicted 3085
7 SASI_Mm02_00423352 predicted 2429
8 SASI_Mm02_00423353 predicted 3212
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481314 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423646 predicted 8153
2 SASI_Mm02_00423647 predicted 10639
3 SASI_Mm02_00423648 predicted 1153
4 SASI_Mm02_00423649 predicted 6449
5 SASI_Mm02_00423650 predicted 4974
6 SASI_Mm02_00423651 predicted 5629
7 SASI_Mm02_00423652 predicted 2284
8 SASI_Mm02_00423653 predicted 3072
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260256 predicted 4556
2 SASI_Mm01_00260257 predicted 3127
3 SASI_Mm01_00260258 predicted 5635
4 SASI_Mm01_00260259 predicted 1430
5 SASI_Mm01_00260260 predicted 333
6 SASI_Mm01_00260261 predicted 3432
7 SASI_Mm01_00260262 predicted 2805
8 SASI_Mm01_00260263 predicted 605
9 SASI_Mm01_00260264 predicted 840
10 SASI_Mm01_00260265 predicted 5675
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004668
VALIDATED
MGAM MISSION shRNA Bacterial Glycerol Stock
maltase-glucoamylase (alpha-glucosidase)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004668.1-5938s1c1
Sequence:CCGGCCACGTTTGTAATCATAGAATCTCGAGATTCTATGATTACAAACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004668.1-5372s1c1
Sequence:CCGGCCAGCCAGAATACGATGCAAACTCGAGTTTGCATCGTATTCTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004668.1-3223s1c1
Sequence:CCGGCCCAACAAGAATCGGTATGAACTCGAGTTCATACCGATTCTTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004668.1-682s1c1
Sequence:CCGGGCTGCTTCTTTGACCTACCAACTCGAGTTGGTAGGTCAAAGAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004668.1-2581s1c1
Sequence:CCGGGCCCTAGATGAGAACAAAGAACTCGAGTTCTTTGTTCTCATCTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004668
VALIDATED
MGAM MISSION shRNA shRNA Plasmid DNA
maltase-glucoamylase (alpha-glucosidase)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004668.1-5938s1c1
Sequence:CCGGCCACGTTTGTAATCATAGAATCTCGAGATTCTATGATTACAAACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004668.1-5372s1c1
Sequence:CCGGCCAGCCAGAATACGATGCAAACTCGAGTTTGCATCGTATTCTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004668.1-3223s1c1
Sequence:CCGGCCCAACAAGAATCGGTATGAACTCGAGTTCATACCGATTCTTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004668.1-682s1c1
Sequence:CCGGGCTGCTTCTTTGACCTACCAACTCGAGTTGGTAGGTCAAAGAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004668.1-2581s1c1
Sequence:CCGGGCCCTAGATGAGAACAAAGAACTCGAGTTCTTTGTTCTCATCTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004668
VALIDATED
MGAM MISSION shRNA Lentiviral Transduction Particles
maltase-glucoamylase (alpha-glucosidase)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004668.1-5938s1c1
Sequence:CCGGCCACGTTTGTAATCATAGAATCTCGAGATTCTATGATTACAAACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004668.1-5372s1c1
Sequence:CCGGCCAGCCAGAATACGATGCAAACTCGAGTTTGCATCGTATTCTGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004668.1-3223s1c1
Sequence:CCGGCCCAACAAGAATCGGTATGAACTCGAGTTCATACCGATTCTTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004668.1-682s1c1
Sequence:CCGGGCTGCTTCTTTGACCTACCAACTCGAGTTGGTAGGTCAAAGAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004668.1-2581s1c1
Sequence:CCGGGCCCTAGATGAGAACAAAGAACTCGAGTTCTTTGTTCTCATCTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)