EMAIL THIS PAGE TO A FRIEND

MGARP

mitochondria-localized glutamic acid-rich protein

75 Gene Product Result for
Synonyms: C4orf49 CESP-1 HUMMR OSAP
UniProtKB ID: Q8TDB4, Q9BZC3
Gene ID:
Mouse(67749) mitochondria localized glutamic acid rich protein
Rat(689931) mitochondria-localized glutamic acid-rich protein
naked mole-rat(101713373) mitochondria-localized glutamic acid-rich protein
sheep(101116766) mitochondria-localized glutamic acid-rich protein
chicken(770869) mitochondria-localized glutamic acid-rich protein
domestic cat(101098627) mitochondria-localized glutamic acid-rich protein
cow(513234) chromosome 17 open reading frame, human C4orf49
dog(607964) mitochondria-localized glutamic acid-rich protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026358 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026358 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026358 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032623 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032623 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032623 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032623 Rosetta Predictions human pricing
NM_001109556 Rosetta Predictions rat pricing
NM_026358 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169013 predicted 672
2 SASI_Hs01_00169014 predicted 730
3 SASI_Hs01_00169015 predicted 736
4 SASI_Hs02_00360175 predicted 293
5 SASI_Hs01_00169017 predicted 347
6 SASI_Hs02_00360176 predicted 259
7 SASI_Hs01_00169018 predicted 439
8 SASI_Hs02_00360177 predicted 293
9 SASI_Hs02_00360178 predicted 269
10 SASI_Hs01_00169021 predicted 735
11 SASI_Hs01_00169016 predicted 238
12 SASI_Hs01_00169019 predicted 470
13 SASI_Hs01_00169020 predicted 215
14 SASI_Hs01_00169022 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109556 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249557 predicted 944
2 SASI_Rn02_00249558 predicted 242
3 SASI_Rn02_00249559 predicted 219
4 SASI_Rn02_00249560 predicted 551
5 SASI_Rn02_00249561 predicted 377
6 SASI_Rn02_00249562 predicted 974
7 SASI_Rn02_00249563 predicted 232
8 SASI_Rn02_00249564 predicted 341
9 SASI_Rn02_00249565 predicted 327
10 SASI_Rn02_00249566 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081340 predicted 689
2 SASI_Mm02_00330075 predicted 820
3 SASI_Mm01_00081341 predicted 516
4 SASI_Mm01_00081342 predicted 325
5 SASI_Mm01_00081343 predicted 258
6 SASI_Mm01_00081344 predicted 206
7 SASI_Mm01_00081345 predicted 256
8 SASI_Mm01_00081346 predicted 223
9 SASI_Mm01_00081347 predicted 735
10 SASI_Mm01_00081348 predicted 309
11 SASI_Mm01_00081349 predicted 674
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026358
MGARP MISSION shRNA Bacterial Glycerol Stock
mitochondria-localized glutamic acid-rich protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026358.2-191s21c1
Sequence:CCGGTACAAGGCTTTAACATCAAAGCTCGAGCTTTGATGTTAAAGCCTTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026358.2-93s21c1
Sequence:CCGGGCCGAATGTCATCCAGGAAATCTCGAGATTTCCTGGATGACATTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026358.1-105s1c1
Sequence:CCGGCCAGGAAATTCCCTGGAACATCTCGAGATGTTCCAGGGAATTTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026358.1-221s1c1
Sequence:CCGGCGTACAGAACATGTAGCTGAACTCGAGTTCAGCTACATGTTCTGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026358.1-569s1c1
Sequence:CCGGGACCAGGATGACGTTTGCAATCTCGAGATTGCAAACGTCATCCTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026358.2-955s21c1
Sequence:CCGGTTTGATTGGGAGTTGGTATTTCTCGAGAAATACCAACTCCCAATCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026358.2-127s21c1
Sequence:CCGGTGGCTCCAATATGATCTATTACTCGAGTAATAGATCATATTGGAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026358.2-166s21c1
Sequence:CCGGAGTCAGTGCTGGTGGATATTACTCGAGTAATATCCACCAGCACTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026358
MGARP MISSION shRNA shRNA Plasmid DNA
mitochondria-localized glutamic acid-rich protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026358.2-191s21c1
Sequence:CCGGTACAAGGCTTTAACATCAAAGCTCGAGCTTTGATGTTAAAGCCTTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026358.2-93s21c1
Sequence:CCGGGCCGAATGTCATCCAGGAAATCTCGAGATTTCCTGGATGACATTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026358.1-105s1c1
Sequence:CCGGCCAGGAAATTCCCTGGAACATCTCGAGATGTTCCAGGGAATTTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026358.1-221s1c1
Sequence:CCGGCGTACAGAACATGTAGCTGAACTCGAGTTCAGCTACATGTTCTGTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026358.1-569s1c1
Sequence:CCGGGACCAGGATGACGTTTGCAATCTCGAGATTGCAAACGTCATCCTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026358.2-955s21c1
Sequence:CCGGTTTGATTGGGAGTTGGTATTTCTCGAGAAATACCAACTCCCAATCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026358.2-127s21c1
Sequence:CCGGTGGCTCCAATATGATCTATTACTCGAGTAATAGATCATATTGGAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026358.2-166s21c1
Sequence:CCGGAGTCAGTGCTGGTGGATATTACTCGAGTAATATCCACCAGCACTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026358
MGARP MISSION shRNA Lentiviral Transduction Particles
mitochondria-localized glutamic acid-rich protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026358.2-191s21c1
Sequence:CCGGTACAAGGCTTTAACATCAAAGCTCGAGCTTTGATGTTAAAGCCTTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026358.2-93s21c1
Sequence:CCGGGCCGAATGTCATCCAGGAAATCTCGAGATTTCCTGGATGACATTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026358.1-105s1c1
Sequence:CCGGCCAGGAAATTCCCTGGAACATCTCGAGATGTTCCAGGGAATTTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026358.1-221s1c1
Sequence:CCGGCGTACAGAACATGTAGCTGAACTCGAGTTCAGCTACATGTTCTGTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026358.1-569s1c1
Sequence:CCGGGACCAGGATGACGTTTGCAATCTCGAGATTGCAAACGTCATCCTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026358.2-955s21c1
Sequence:CCGGTTTGATTGGGAGTTGGTATTTCTCGAGAAATACCAACTCCCAATCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026358.2-127s21c1
Sequence:CCGGTGGCTCCAATATGATCTATTACTCGAGTAATAGATCATATTGGAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026358.2-166s21c1
Sequence:CCGGAGTCAGTGCTGGTGGATATTACTCGAGTAATATCCACCAGCACTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032623
VALIDATED
MGARP MISSION shRNA Bacterial Glycerol Stock
mitochondria-localized glutamic acid-rich protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032623.3-345s21c1
Sequence:CCGGAGTCAGTGCTGGTGGATATTACTCGAGTAATATCCACCAGCACTGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032623.3-296s21c1
Sequence:CCGGCTGGATCATCTGGATCAAATACTCGAGTATTTGATCCAGATGATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032623.3-736s21c1
Sequence:CCGGGAAGCTGTCACCATCGATAATCTCGAGATTATCGATGGTGACAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032623.3-903s21c1
Sequence:CCGGATCTCCAGCCGGTAGACATTTCTCGAGAAATGTCTACCGGCTGGAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032623.3-774s21c1
Sequence:CCGGGAACGAAACCTCTGATGAATACTCGAGTATTCATCAGAGGTTTCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032623.2-1001s1c1
Sequence:CCGGCAGAATATGACATTGCAGTAACTCGAGTTACTGCAATGTCATATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032623.2-994s1c1
Sequence:CCGGCTGAGATCAGAATATGACATTCTCGAGAATGTCATATTCTGATCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032623.2-395s1c1
Sequence:CCGGCCAGAAGAACTTATAGTGGAACTCGAGTTCCACTATAAGTTCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032623.2-570s1c1
Sequence:CCGGCCACGGAAGTAAACCCTGAAACTCGAGTTTCAGGGTTTACTTCCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032623.3-560s21c1
Sequence:CCGCGTGCTACAGTTGTGGTCATAACTCGAGTTATGACCACAACTGTAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032623
VALIDATED
MGARP MISSION shRNA shRNA Plasmid DNA
mitochondria-localized glutamic acid-rich protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032623.3-345s21c1
Sequence:CCGGAGTCAGTGCTGGTGGATATTACTCGAGTAATATCCACCAGCACTGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032623.3-296s21c1
Sequence:CCGGCTGGATCATCTGGATCAAATACTCGAGTATTTGATCCAGATGATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032623.3-736s21c1
Sequence:CCGGGAAGCTGTCACCATCGATAATCTCGAGATTATCGATGGTGACAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032623.3-903s21c1
Sequence:CCGGATCTCCAGCCGGTAGACATTTCTCGAGAAATGTCTACCGGCTGGAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032623.3-774s21c1
Sequence:CCGGGAACGAAACCTCTGATGAATACTCGAGTATTCATCAGAGGTTTCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032623.2-1001s1c1
Sequence:CCGGCAGAATATGACATTGCAGTAACTCGAGTTACTGCAATGTCATATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032623.2-994s1c1
Sequence:CCGGCTGAGATCAGAATATGACATTCTCGAGAATGTCATATTCTGATCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032623.2-395s1c1
Sequence:CCGGCCAGAAGAACTTATAGTGGAACTCGAGTTCCACTATAAGTTCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032623.2-570s1c1
Sequence:CCGGCCACGGAAGTAAACCCTGAAACTCGAGTTTCAGGGTTTACTTCCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032623.3-560s21c1
Sequence:CCGCGTGCTACAGTTGTGGTCATAACTCGAGTTATGACCACAACTGTAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032623
VALIDATED
MGARP MISSION shRNA Lentiviral Transduction Particles
mitochondria-localized glutamic acid-rich protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032623.3-345s21c1
Sequence:CCGGAGTCAGTGCTGGTGGATATTACTCGAGTAATATCCACCAGCACTGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032623.3-296s21c1
Sequence:CCGGCTGGATCATCTGGATCAAATACTCGAGTATTTGATCCAGATGATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032623.3-736s21c1
Sequence:CCGGGAAGCTGTCACCATCGATAATCTCGAGATTATCGATGGTGACAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032623.3-903s21c1
Sequence:CCGGATCTCCAGCCGGTAGACATTTCTCGAGAAATGTCTACCGGCTGGAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032623.3-774s21c1
Sequence:CCGGGAACGAAACCTCTGATGAATACTCGAGTATTCATCAGAGGTTTCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032623.2-1001s1c1
Sequence:CCGGCAGAATATGACATTGCAGTAACTCGAGTTACTGCAATGTCATATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032623.2-994s1c1
Sequence:CCGGCTGAGATCAGAATATGACATTCTCGAGAATGTCATATTCTGATCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032623.2-395s1c1
Sequence:CCGGCCAGAAGAACTTATAGTGGAACTCGAGTTCCACTATAAGTTCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032623.2-570s1c1
Sequence:CCGGCCACGGAAGTAAACCCTGAAACTCGAGTTTCAGGGTTTACTTCCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032623.3-560s21c1
Sequence:CCGCGTGCTACAGTTGTGGTCATAACTCGAGTTATGACCACAACTGTAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)