EMAIL THIS PAGE TO A FRIEND

MGAT1

mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase

117 Gene Product Result for
Synonyms: GLCNAC-TI GLCT1 GLYT1 GNT-1 GNT-I MGAT
UniProtKB ID: P26572, A8K404, D3DWR1, Q6IBE3
Gene ID:
Human(4245) Summary: There are believed to be over 100 different glycosyltransferases involved in the synthesis of protein-bound and lipid-bound oligosaccharides. UDP-N-acetylglucosamine:alpha-3-D-mannoside beta-1,2-N-acetylglucosaminyltransferase I is a medial-Golgi enzyme essential for the synthesis of hybrid and complex N-glycans. The protein, encoded by a single exon, shows typical features of a type II transmembrane protein. The protein is believed to be essential for normal embryogenesis. Several variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(17308) mannoside acetylglucosaminyltransferase 1
Rat(81519) mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
fruit fly(37323) UDP-GlcNAc:a-3-D-mannoside-beta-1,2-N-acetylglucosaminyltransferase I
cow(534248) mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
domestic cat(101082035) mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
dog(491674) mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
sheep(101104744) mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
domestic guinea pig(100733330) mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002406 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002406 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002406 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010794 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010794 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010794 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114617 Rosetta Predictions human pricing
NM_001114618 Rosetta Predictions human pricing
NM_001114619 Rosetta Predictions human pricing
NM_001114620 Rosetta Predictions human pricing
NM_002406 Rosetta Predictions human pricing
NM_030861 Rosetta Predictions rat pricing
NM_001110148 Rosetta Predictions mouse pricing
NM_001110149 Rosetta Predictions mouse pricing
NM_001110150 Rosetta Predictions mouse pricing
NM_010794 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326664 predicted 1961
2 SASI_Hs02_00326665 predicted 757
3 SASI_Hs02_00326666 predicted 1712
4 SASI_Hs02_00326667 predicted 1177
5 SASI_Hs02_00326668 predicted 2294
6 SASI_Hs02_00326669 predicted 1825
7 SASI_Hs02_00326670 predicted 1365
8 SASI_Hs02_00326671 predicted 2307
9 SASI_Hs02_00326672 predicted 1852
10 SASI_Hs02_00326673 predicted 1564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326674 predicted 2050
2 SASI_Hs02_00326675 predicted 850
3 SASI_Hs02_00326676 predicted 1805
4 SASI_Hs02_00326677 predicted 1262
5 SASI_Hs02_00326678 predicted 2386
6 SASI_Hs02_00326679 predicted 1915
7 SASI_Hs02_00326680 predicted 1452
8 SASI_Hs02_00326681 predicted 2395
9 SASI_Hs02_00326682 predicted 1938
10 SASI_Hs02_00326683 predicted 1652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326684 predicted 1528
2 SASI_Hs02_00326685 predicted 321
3 SASI_Hs02_00326686 predicted 1273
4 SASI_Hs02_00326687 predicted 737
5 SASI_Hs02_00326688 predicted 1857
6 SASI_Hs02_00326689 predicted 1391
7 SASI_Hs02_00326690 predicted 933
8 SASI_Hs02_00326691 predicted 1869
9 SASI_Hs02_00326692 predicted 1420
10 SASI_Hs02_00326693 predicted 1128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326694 predicted 1738
2 SASI_Hs02_00326695 predicted 532
3 SASI_Hs02_00326696 predicted 1485
4 SASI_Hs02_00326697 predicted 948
5 SASI_Hs02_00326698 predicted 2068
6 SASI_Hs02_00326699 predicted 1596
7 SASI_Hs02_00326700 predicted 1145
8 SASI_Hs02_00326701 predicted 2079
9 SASI_Hs02_00326702 predicted 1629
10 SASI_Hs02_00326703 predicted 1335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073060 predicted 1804
2 SASI_Hs01_00073061 predicted 601
3 SASI_Hs01_00073062 predicted 1560
4 SASI_Hs01_00073063 predicted 1016
5 SASI_Hs01_00073064 predicted 2134
6 SASI_Hs01_00073065 predicted 1665
7 SASI_Hs01_00073066 predicted 1207
8 SASI_Hs01_00073067 predicted 2149
9 SASI_Hs01_00073068 predicted 1696
10 SASI_Hs02_00333780 predicted 1404
11 SASI_Hs01_00073069 predicted 1966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030861 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264110 predicted 1128
2 SASI_Rn01_00118797 predicted 1471
3 SASI_Rn01_00118798 predicted 1562
4 SASI_Rn02_00264111 predicted 574
5 SASI_Rn01_00118799 predicted 688
6 SASI_Rn01_00118800 predicted 526
7 SASI_Rn01_00118801 predicted 1097
8 SASI_Rn01_00118802 predicted 612
9 SASI_Rn01_00118803 predicted 484
10 SASI_Rn01_00118804 predicted 872
11 SASI_Rn01_00118796 predicted 1077
12 SASI_Rn01_00118805 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110148 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304746 predicted 2133
2 SASI_Mm02_00304747 predicted 1271
3 SASI_Mm02_00304748 predicted 1467
4 SASI_Mm02_00304749 predicted 1755
5 SASI_Mm02_00304750 predicted 1350
6 SASI_Mm02_00304751 predicted 1153
7 SASI_Mm02_00304752 predicted 2136
8 SASI_Mm02_00304753 predicted 1786
9 SASI_Mm02_00304754 predicted 1715
10 SASI_Mm02_00304755 predicted 1938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304756 predicted 1490
2 SASI_Mm02_00304757 predicted 623
3 SASI_Mm02_00304758 predicted 827
4 SASI_Mm02_00304759 predicted 1112
5 SASI_Mm02_00304760 predicted 707
6 SASI_Mm02_00304761 predicted 504
7 SASI_Mm02_00304762 predicted 1494
8 SASI_Mm02_00304763 predicted 1145
9 SASI_Mm02_00304764 predicted 1073
10 SASI_Mm02_00304765 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110150 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304766 predicted 1665
2 SASI_Mm02_00304767 predicted 806
3 SASI_Mm02_00304768 predicted 999
4 SASI_Mm02_00304769 predicted 1287
5 SASI_Mm02_00304770 predicted 879
6 SASI_Mm02_00304771 predicted 677
7 SASI_Mm02_00304772 predicted 1670
8 SASI_Mm02_00304773 predicted 1324
9 SASI_Mm02_00304774 predicted 1243
10 SASI_Mm02_00304775 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054258 predicted 2007
2 SASI_Mm01_00054259 predicted 1142
3 SASI_Mm01_00054260 predicted 1341
4 SASI_Mm01_00054261 predicted 1633
5 SASI_Mm01_00054262 predicted 1222
6 SASI_Mm01_00054263 predicted 1021
7 SASI_Mm02_00319364 predicted 2011
8 SASI_Mm01_00054265 predicted 1661
9 SASI_Mm01_00054267 predicted 1593
10 SASI_Mm02_00319365 predicted 1809
11 SASI_Mm01_00054264 predicted 853
12 SASI_Mm01_00054266 predicted 1758
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002406
VALIDATED
MGAT1 MISSION shRNA Bacterial Glycerol Stock
mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002406.3-1410s21c1
Sequence:CCGGCCCTGAGATCTCAAGAACGATCTCGAGATCGTTCTTGAGATCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002406.3-1476s21c1
Sequence:CCGGGCACCTCAAGTTTATCAAGCTCTCGAGAGCTTGATAAACTTGAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002406.3-1960s21c1
Sequence:CCGGGTGGCATTTAAGTGCACAAATCTCGAGATTTGTGCACTTAAATGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002406.3-1812s21c1
Sequence:CCGGCTATGATCCTAGCTGGAATTACTCGAGTAATTCCAGCTAGGATCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002406.3-1141s21c1
Sequence:CCGGCCGGACTTCTTCGAGTACTTTCTCGAGAAAGTACTCGAAGAAGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002406.2-1021s1c1
Sequence:CCGGCCACCGCAAGTTCCAGGGCTACTCGAGTAGCCCTGGAACTTGCGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002406.2-1477s1c1
Sequence:CCGGGCACCTCAAGTTTATCAAGCTCTCGAGAGCTTGATAAACTTGAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002406.2-1411s1c1
Sequence:CCGGCCCTGAGATCTCAAGAACGATCTCGAGATCGTTCTTGAGATCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002406.2-860s1c1
Sequence:CCGGCTGGACAAGCTGCTGCATTATCTCGAGATAATGCAGCAGCTTGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002406.2-1142s1c1
Sequence:CCGGCCGGACTTCTTCGAGTACTTTCTCGAGAAAGTACTCGAAGAAGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002406
VALIDATED
MGAT1 MISSION shRNA shRNA Plasmid DNA
mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002406.3-1410s21c1
Sequence:CCGGCCCTGAGATCTCAAGAACGATCTCGAGATCGTTCTTGAGATCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002406.3-1476s21c1
Sequence:CCGGGCACCTCAAGTTTATCAAGCTCTCGAGAGCTTGATAAACTTGAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002406.3-1960s21c1
Sequence:CCGGGTGGCATTTAAGTGCACAAATCTCGAGATTTGTGCACTTAAATGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002406.3-1812s21c1
Sequence:CCGGCTATGATCCTAGCTGGAATTACTCGAGTAATTCCAGCTAGGATCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002406.3-1141s21c1
Sequence:CCGGCCGGACTTCTTCGAGTACTTTCTCGAGAAAGTACTCGAAGAAGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002406.2-1021s1c1
Sequence:CCGGCCACCGCAAGTTCCAGGGCTACTCGAGTAGCCCTGGAACTTGCGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002406.2-1477s1c1
Sequence:CCGGGCACCTCAAGTTTATCAAGCTCTCGAGAGCTTGATAAACTTGAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002406.2-1411s1c1
Sequence:CCGGCCCTGAGATCTCAAGAACGATCTCGAGATCGTTCTTGAGATCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002406.2-860s1c1
Sequence:CCGGCTGGACAAGCTGCTGCATTATCTCGAGATAATGCAGCAGCTTGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002406.2-1142s1c1
Sequence:CCGGCCGGACTTCTTCGAGTACTTTCTCGAGAAAGTACTCGAAGAAGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002406
VALIDATED
MGAT1 MISSION shRNA Lentiviral Transduction Particles
mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002406.3-1410s21c1
Sequence:CCGGCCCTGAGATCTCAAGAACGATCTCGAGATCGTTCTTGAGATCTCAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000315814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002406.3-1476s21c1
Sequence:CCGGGCACCTCAAGTTTATCAAGCTCTCGAGAGCTTGATAAACTTGAGGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000294495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002406.3-1960s21c1
Sequence:CCGGGTGGCATTTAAGTGCACAAATCTCGAGATTTGTGCACTTAAATGCCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000294494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002406.3-1812s21c1
Sequence:CCGGCTATGATCCTAGCTGGAATTACTCGAGTAATTCCAGCTAGGATCATAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000315891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002406.3-1141s21c1
Sequence:CCGGCCGGACTTCTTCGAGTACTTTCTCGAGAAAGTACTCGAAGAAGTCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000035197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002406.2-1021s1c1
Sequence:CCGGCCACCGCAAGTTCCAGGGCTACTCGAGTAGCCCTGGAACTTGCGGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000035198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002406.2-1477s1c1
Sequence:CCGGGCACCTCAAGTTTATCAAGCTCTCGAGAGCTTGATAAACTTGAGGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000035196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002406.2-1411s1c1
Sequence:CCGGCCCTGAGATCTCAAGAACGATCTCGAGATCGTTCTTGAGATCTCAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000035195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002406.2-860s1c1
Sequence:CCGGCTGGACAAGCTGCTGCATTATCTCGAGATAATGCAGCAGCTTGTCCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000035194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002406.2-1142s1c1
Sequence:CCGGCCGGACTTCTTCGAGTACTTTCTCGAGAAAGTACTCGAAGAAGTCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010794
VALIDATED
MGAT1 MISSION shRNA Bacterial Glycerol Stock
mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010794.3-2234s21c1
Sequence:CCGGCCTGTTGTCAAGGGAGTATTGCTCGAGCAATACTCCCTTGACAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010794.3-1058s21c1
Sequence:CCGGGCGCTGCTTGGATAAGTTGTTCTCGAGAACAACTTATCCAAGCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010794.3-1670s21c1
Sequence:CCGGGTTCTTTGACCAGCATCTTAACTCGAGTTAAGATGCTGGTCAAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010794.3-1947s21c1
Sequence:CCGGTACCGTGGCATTGTCACTTTCCTCGAGGAAAGTGACAATGCCACGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010794.2-1414s1c1
Sequence:CCGGGCTGCTCTATCGAACAGACTTCTCGAGAAGTCTGTTCGATAGAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010794.2-1962s1c1
Sequence:CCGGGCTATGATCCTAGCTGGAATTCTCGAGAATTCCAGCTAGGATCATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010794.2-1550s1c1
Sequence:CCGGGCTTGTATTCGTCCAGAAATTCTCGAGAATTTCTGGACGAATACAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010794.2-1003s1c1
Sequence:CCGGGCGCTGCTTGGATAAGTTGTTCTCGAGAACAACTTATCCAAGCAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010794.2-856s1c1
Sequence:CCGGGCAGCAAATCAAGGAGCATTACTCGAGTAATGCTCCTTGATTTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010794.3-1192s21c1
Sequence:CCGGAGCCGGACCTGAGTAACATTGCTCGAGCAATGTTACTCAGGTCCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010794
VALIDATED
MGAT1 MISSION shRNA shRNA Plasmid DNA
mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010794.3-2234s21c1
Sequence:CCGGCCTGTTGTCAAGGGAGTATTGCTCGAGCAATACTCCCTTGACAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010794.3-1058s21c1
Sequence:CCGGGCGCTGCTTGGATAAGTTGTTCTCGAGAACAACTTATCCAAGCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010794.3-1670s21c1
Sequence:CCGGGTTCTTTGACCAGCATCTTAACTCGAGTTAAGATGCTGGTCAAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010794.3-1947s21c1
Sequence:CCGGTACCGTGGCATTGTCACTTTCCTCGAGGAAAGTGACAATGCCACGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010794.2-1414s1c1
Sequence:CCGGGCTGCTCTATCGAACAGACTTCTCGAGAAGTCTGTTCGATAGAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010794.2-1962s1c1
Sequence:CCGGGCTATGATCCTAGCTGGAATTCTCGAGAATTCCAGCTAGGATCATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010794.2-1550s1c1
Sequence:CCGGGCTTGTATTCGTCCAGAAATTCTCGAGAATTTCTGGACGAATACAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010794.2-1003s1c1
Sequence:CCGGGCGCTGCTTGGATAAGTTGTTCTCGAGAACAACTTATCCAAGCAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010794.2-856s1c1
Sequence:CCGGGCAGCAAATCAAGGAGCATTACTCGAGTAATGCTCCTTGATTTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010794.3-1192s21c1
Sequence:CCGGAGCCGGACCTGAGTAACATTGCTCGAGCAATGTTACTCAGGTCCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010794
VALIDATED
MGAT1 MISSION shRNA Lentiviral Transduction Particles
mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010794.3-2234s21c1
Sequence:CCGGCCTGTTGTCAAGGGAGTATTGCTCGAGCAATACTCCCTTGACAACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000285924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010794.3-1058s21c1
Sequence:CCGGGCGCTGCTTGGATAAGTTGTTCTCGAGAACAACTTATCCAAGCAGCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000277289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010794.3-1670s21c1
Sequence:CCGGGTTCTTTGACCAGCATCTTAACTCGAGTTAAGATGCTGGTCAAAGAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000285926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010794.3-1947s21c1
Sequence:CCGGTACCGTGGCATTGTCACTTTCCTCGAGGAAAGTGACAATGCCACGGTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000018845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010794.2-1414s1c1
Sequence:CCGGGCTGCTCTATCGAACAGACTTCTCGAGAAGTCTGTTCGATAGAGCAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000018455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010794.2-1962s1c1
Sequence:CCGGGCTATGATCCTAGCTGGAATTCTCGAGAATTCCAGCTAGGATCATAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000018454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010794.2-1550s1c1
Sequence:CCGGGCTTGTATTCGTCCAGAAATTCTCGAGAATTTCTGGACGAATACAAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000018846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010794.2-1003s1c1
Sequence:CCGGGCGCTGCTTGGATAAGTTGTTCTCGAGAACAACTTATCCAAGCAGCGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000018453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010794.2-856s1c1
Sequence:CCGGGCAGCAAATCAAGGAGCATTACTCGAGTAATGCTCCTTGATTTGCTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000277248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010794.3-1192s21c1
Sequence:CCGGAGCCGGACCTGAGTAACATTGCTCGAGCAATGTTACTCAGGTCCGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???