EMAIL THIS PAGE TO A FRIEND

MGAT2

mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase

63 Gene Product Result for
Synonyms: CDG2A CDGS2 GLCNACTII GNT-II GNT2
UniProtKB ID: Q10469, B3KPC5
Gene ID:
Human(4247) Summary: The product of this gene is a Golgi enzyme catalyzing an essential step in the conversion of oligomannose to complex N-glycans. The enzyme has the typical glycosyltransferase domains: a short N-terminal cytoplasmic domain, a hydrophobic non-cleavable signal-anchor domain, and a C-terminal catalytic domain. Mutations in this gene may lead to carbohydrate-deficient glycoprotein syndrome, type II. The coding region of this gene is intronless. Transcript variants with a spliced 5' UTR may exist, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(217664) mannoside acetylglucosaminyltransferase 2
Rat(94273) mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
Zebrafish(100000478) mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
chicken(428925) mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
fruit fly(43563) CG7921 gene product from transcript CG7921-RB
cow(539918) mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
cow(101906103) mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
domestic cat(101092119) mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
dog(480312) mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
domestic guinea pig(100724305) mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
naked mole-rat(101707621) mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
Domestic Rabbit(100348676) mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
sheep(101122525) mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146035 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146035 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146035 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002408 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002408 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002408 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015883 Rosetta Predictions human pricing
NM_002408 Rosetta Predictions human pricing
NM_053604 Rosetta Predictions rat pricing
NM_146035 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015883 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098072 predicted 1310
2 SASI_Hs01_00098073 predicted 1591
3 SASI_Hs01_00098074 predicted 1485
4 SASI_Hs01_00098075 predicted 1207
5 SASI_Hs01_00098076 predicted 1319
6 SASI_Hs01_00098077 predicted 1480
7 SASI_Hs01_00098078 predicted 1697
8 SASI_Hs01_00098079 predicted 1350
9 SASI_Hs01_00098080 predicted 1436
10 SASI_Hs01_00098081 predicted 1234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113157 predicted 1500
2 SASI_Hs01_00113158 predicted 1789
3 SASI_Hs01_00113159 predicted 1668
4 SASI_Hs01_00113160 predicted 1401
5 SASI_Hs01_00113161 predicted 1510
6 SASI_Hs02_00333782 predicted 1099
7 SASI_Hs02_00333783 predicted 1153
8 SASI_Hs02_00333784 predicted 954
9 SASI_Hs01_00113162 predicted 1671
10 SASI_Hs01_00113163 predicted 1886
11 SASI_Hs01_00113164 predicted 1550
12 SASI_Hs01_00113165 predicted 1626
13 SASI_Hs01_00113166 predicted 1425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266301 predicted 1150
2 SASI_Rn01_00094071 predicted 1646
3 SASI_Rn01_00094072 predicted 1600
4 SASI_Rn01_00094073 predicted 1829
5 SASI_Rn01_00094074 predicted 1550
6 SASI_Rn01_00094075 predicted 1083
7 SASI_Rn01_00094076 predicted 847
8 SASI_Rn01_00094077 predicted 978
9 SASI_Rn01_00094078 predicted 1328
10 SASI_Rn02_00266302 predicted 1361
11 SASI_Rn01_00094069 predicted 1718
12 SASI_Rn01_00094070 predicted 1445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146035 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154144 predicted 873
2 SASI_Mm01_00154145 predicted 1467
3 SASI_Mm01_00154146 predicted 858
4 SASI_Mm01_00154147 predicted 1136
5 SASI_Mm01_00154148 predicted 901
6 SASI_Mm01_00154149 predicted 873
7 SASI_Mm01_00154150 predicted 1147
8 SASI_Mm01_00154151 predicted 899
9 SASI_Mm01_00154152 predicted 1489
10 SASI_Mm01_00154153 predicted 1456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146035
VALIDATED
MGAT2 MISSION shRNA Bacterial Glycerol Stock
mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146035.1-1336s1c1
Sequence:CCGGGCTGACAAAGTAGATGTGAAACTCGAGTTTCACATCTACTTTGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146035.1-1099s1c1
Sequence:CCGGGCCAAGTTCTCACAAACCAAACTCGAGTTTGGTTTGTGAGAACTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146035.1-1603s1c1
Sequence:CCGGGCCCAAATTGAGTCATTATTACTCGAGTAATAATGACTCAATTTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146035.1-1427s1c1
Sequence:CCGGGCACGGACACTTTCTGTACTTCTCGAGAAGTACAGAAAGTGTCCGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146035.1-1015s1c1
Sequence:CCGGCCCAGAGACCTAAAGAAGAATCTCGAGATTCTTCTTTAGGTCTCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146035.2-1658s21c1
Sequence:CCGGGCCCAAATTGAGTCATTATTACTCGAGTAATAATGACTCAATTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146035.2-1482s21c1
Sequence:CCGGGCACGGACACTTTCTGTACTTCTCGAGAAGTACAGAAAGTGTCCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146035.2-1391s21c1
Sequence:CCGGGCTGACAAAGTAGATGTGAAACTCGAGTTTCACATCTACTTTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146035.2-1154s21c1
Sequence:CCGGGCCAAGTTCTCACAAACCAAACTCGAGTTTGGTTTGTGAGAACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146035
VALIDATED
MGAT2 MISSION shRNA shRNA Plasmid DNA
mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146035.1-1336s1c1
Sequence:CCGGGCTGACAAAGTAGATGTGAAACTCGAGTTTCACATCTACTTTGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146035.1-1099s1c1
Sequence:CCGGGCCAAGTTCTCACAAACCAAACTCGAGTTTGGTTTGTGAGAACTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146035.1-1603s1c1
Sequence:CCGGGCCCAAATTGAGTCATTATTACTCGAGTAATAATGACTCAATTTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146035.1-1427s1c1
Sequence:CCGGGCACGGACACTTTCTGTACTTCTCGAGAAGTACAGAAAGTGTCCGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146035.1-1015s1c1
Sequence:CCGGCCCAGAGACCTAAAGAAGAATCTCGAGATTCTTCTTTAGGTCTCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146035.2-1658s21c1
Sequence:CCGGGCCCAAATTGAGTCATTATTACTCGAGTAATAATGACTCAATTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146035.2-1482s21c1
Sequence:CCGGGCACGGACACTTTCTGTACTTCTCGAGAAGTACAGAAAGTGTCCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146035.2-1391s21c1
Sequence:CCGGGCTGACAAAGTAGATGTGAAACTCGAGTTTCACATCTACTTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146035.2-1154s21c1
Sequence:CCGGGCCAAGTTCTCACAAACCAAACTCGAGTTTGGTTTGTGAGAACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146035
VALIDATED
MGAT2 MISSION shRNA Lentiviral Transduction Particles
mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146035.1-1336s1c1
Sequence:CCGGGCTGACAAAGTAGATGTGAAACTCGAGTTTCACATCTACTTTGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146035.1-1099s1c1
Sequence:CCGGGCCAAGTTCTCACAAACCAAACTCGAGTTTGGTTTGTGAGAACTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146035.1-1603s1c1
Sequence:CCGGGCCCAAATTGAGTCATTATTACTCGAGTAATAATGACTCAATTTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146035.1-1427s1c1
Sequence:CCGGGCACGGACACTTTCTGTACTTCTCGAGAAGTACAGAAAGTGTCCGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146035.1-1015s1c1
Sequence:CCGGCCCAGAGACCTAAAGAAGAATCTCGAGATTCTTCTTTAGGTCTCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146035.2-1658s21c1
Sequence:CCGGGCCCAAATTGAGTCATTATTACTCGAGTAATAATGACTCAATTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146035.2-1482s21c1
Sequence:CCGGGCACGGACACTTTCTGTACTTCTCGAGAAGTACAGAAAGTGTCCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146035.2-1391s21c1
Sequence:CCGGGCTGACAAAGTAGATGTGAAACTCGAGTTTCACATCTACTTTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146035.2-1154s21c1
Sequence:CCGGGCCAAGTTCTCACAAACCAAACTCGAGTTTGGTTTGTGAGAACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002408
VALIDATED
MGAT2 MISSION shRNA Bacterial Glycerol Stock
mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002408.2-1666s1c1
Sequence:CCGGGCCCAAATTGAGTCACTCTTACTCGAGTAAGAGTGACTCAATTTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002408.3-1157s21c1
Sequence:CCGGGCCATTATAGAGAGGCCAAATCTCGAGATTTGGCCTCTCTATAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002408.3-1675s21c1
Sequence:CCGGGCCCAAATTGAGTCACTCTTACTCGAGTAAGAGTGACTCAATTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002408.2-1148s1c1
Sequence:CCGGGCCATTATAGAGAGGCCAAATCTCGAGATTTGGCCTCTCTATAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002408.2-1090s1c1
Sequence:CCGGCCGAAGAATGCCGCTTTGAAACTCGAGTTTCAAAGCGGCATTCTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002408.2-2219s1c1
Sequence:CCGGCGATGAAATTGTTAGGGTATTCTCGAGAATACCCTAACAATTTCATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002408.2-1399s1c1
Sequence:CCGGGCTGACAAGGTAGATGTGAAACTCGAGTTTCACATCTACCTTGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002408.3-1099s21c1
Sequence:CCGGCCGAAGAATGCCGCTTTGAAACTCGAGTTTCAAAGCGGCATTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002408.3-2228s21c1
Sequence:CCGGCGATGAAATTGTTAGGGTATTCTCGAGAATACCCTAACAATTTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002408.3-1408s21c1
Sequence:CCGGGCTGACAAGGTAGATGTGAAACTCGAGTTTCACATCTACCTTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002408
VALIDATED
MGAT2 MISSION shRNA shRNA Plasmid DNA
mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002408.2-1666s1c1
Sequence:CCGGGCCCAAATTGAGTCACTCTTACTCGAGTAAGAGTGACTCAATTTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002408.3-1157s21c1
Sequence:CCGGGCCATTATAGAGAGGCCAAATCTCGAGATTTGGCCTCTCTATAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002408.3-1675s21c1
Sequence:CCGGGCCCAAATTGAGTCACTCTTACTCGAGTAAGAGTGACTCAATTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002408.2-1148s1c1
Sequence:CCGGGCCATTATAGAGAGGCCAAATCTCGAGATTTGGCCTCTCTATAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002408.2-1090s1c1
Sequence:CCGGCCGAAGAATGCCGCTTTGAAACTCGAGTTTCAAAGCGGCATTCTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002408.2-2219s1c1
Sequence:CCGGCGATGAAATTGTTAGGGTATTCTCGAGAATACCCTAACAATTTCATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002408.2-1399s1c1
Sequence:CCGGGCTGACAAGGTAGATGTGAAACTCGAGTTTCACATCTACCTTGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002408.3-1099s21c1
Sequence:CCGGCCGAAGAATGCCGCTTTGAAACTCGAGTTTCAAAGCGGCATTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002408.3-2228s21c1
Sequence:CCGGCGATGAAATTGTTAGGGTATTCTCGAGAATACCCTAACAATTTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002408.3-1408s21c1
Sequence:CCGGGCTGACAAGGTAGATGTGAAACTCGAGTTTCACATCTACCTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002408
VALIDATED
MGAT2 MISSION shRNA Lentiviral Transduction Particles
mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002408.2-1666s1c1
Sequence:CCGGGCCCAAATTGAGTCACTCTTACTCGAGTAAGAGTGACTCAATTTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002408.3-1157s21c1
Sequence:CCGGGCCATTATAGAGAGGCCAAATCTCGAGATTTGGCCTCTCTATAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002408.3-1675s21c1
Sequence:CCGGGCCCAAATTGAGTCACTCTTACTCGAGTAAGAGTGACTCAATTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002408.2-1148s1c1
Sequence:CCGGGCCATTATAGAGAGGCCAAATCTCGAGATTTGGCCTCTCTATAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002408.2-1090s1c1
Sequence:CCGGCCGAAGAATGCCGCTTTGAAACTCGAGTTTCAAAGCGGCATTCTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002408.2-2219s1c1
Sequence:CCGGCGATGAAATTGTTAGGGTATTCTCGAGAATACCCTAACAATTTCATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002408.2-1399s1c1
Sequence:CCGGGCTGACAAGGTAGATGTGAAACTCGAGTTTCACATCTACCTTGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002408.3-1099s21c1
Sequence:CCGGCCGAAGAATGCCGCTTTGAAACTCGAGTTTCAAAGCGGCATTCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002408.3-2228s21c1
Sequence:CCGGCGATGAAATTGTTAGGGTATTCTCGAGAATACCCTAACAATTTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002408.3-1408s21c1
Sequence:CCGGGCTGACAAGGTAGATGTGAAACTCGAGTTTCACATCTACCTTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)