EMAIL THIS PAGE TO A FRIEND

MGAT4A

mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A

160 Gene Product Result for
Synonyms: GNT-IV GNT-IVA GnT-4a
UniProtKB ID: Q9UM21, B4E2R6, D3DVH6, E9PEN2, Q53S97, Q86Z15
Gene ID:
Human(11320) Summary: This gene encodes a key glycosyltransferase that regulates the formation of tri- and multiantennary branching structures in the Golgi apparatus. The encoded protein, in addition to the related isoenzyme B, catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc in a beta-1,4 linkage to the Man-alpha-1,3-Man-beta-1,4-GlcNAc arm of R-Man-alpha-1,6(GlcNAc-beta-1,2-Man-alpha-1,3)Man-beta-1, 4-GlcNAc-beta-1,4-GlcNAc-beta-1-Asn. The encoded protein may play a role in regulating the availability of serum glycoproteins, oncogenesis, and differentiation. [provided by RefSeq, Jul 2008]
Mouse(269181) mannoside acetylglucosaminyltransferase 4, isoenzyme A
Rat(367252) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A
Zebrafish(563038) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A
cow(282276) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A
Horse(100050964) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A
domestic cat(101088153) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A
dog(474562) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A
chicken(418692) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A
domestic guinea pig(100721993) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A
naked mole-rat(101722510) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A
Domestic Rabbit(100338722) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A
sheep(101108820) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173870 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173870 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173870 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012214 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012214 Rosetta Predictions human pricing
NM_001012225 Rosetta Predictions rat pricing
XM_576545 Rosetta Predictions rat pricing
NM_173870 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038603 predicted 681
2 SASI_Hs02_00343880 predicted 451
3 SASI_Hs01_00038605 predicted 1745
4 SASI_Hs01_00038606 predicted 325
5 SASI_Hs01_00038607 predicted 809
6 SASI_Hs01_00038608 predicted 1159
7 SASI_Hs01_00038610 predicted 443
8 SASI_Hs01_00038611 predicted 1489
9 SASI_Hs01_00038612 predicted 1626
10 SASI_Hs02_00343881 predicted 1502
11 SASI_Hs01_00038604 predicted 1762
12 SASI_Hs01_00038609 predicted 1668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012225 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105217 predicted 542
2 SASI_Rn01_00105218 predicted 1062
3 SASI_Rn01_00105219 predicted 1625
4 SASI_Rn01_00105221 predicted 1663
5 SASI_Rn01_00105222 predicted 704
6 SASI_Rn02_00200483 predicted 700
7 SASI_Rn01_00105224 predicted 655
8 SASI_Rn01_00105225 predicted 1666
9 SASI_Rn01_00105226 predicted 1542
10 SASI_Rn02_00200484 predicted 1082
11 SASI_Rn01_00105220 predicted 628
12 SASI_Rn01_00105223 predicted 1519
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576545 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184775 predicted 372
2 SASI_Rn01_00184776 predicted 319
3 SASI_Rn01_00184777 predicted 370
4 SASI_Rn01_00184778 predicted 405
5 SASI_Rn01_00184779 predicted 377
6 SASI_Rn01_00184780 predicted 372
7 SASI_Rn01_00184781 predicted 409
8 SASI_Rn01_00184782 predicted 366
9 SASI_Rn01_00184783 predicted 298
10 SASI_Rn01_00184784 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173870 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148030 predicted 512
2 SASI_Mm02_00345465 predicted 1644
3 SASI_Mm01_00148033 predicted 599
4 SASI_Mm01_00148034 predicted 357
5 SASI_Mm01_00148035 predicted 1518
6 SASI_Mm01_00148036 predicted 1565
7 SASI_Mm02_00345466 predicted 1650
8 SASI_Mm01_00148037 predicted 1247
9 SASI_Mm01_00148038 predicted 381
10 SASI_Mm01_00148039 predicted 908
11 SASI_Mm01_00148031 predicted 1449
12 SASI_Mm01_00148032 predicted 1436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173870
MGAT4A MISSION shRNA Bacterial Glycerol Stock
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173870.1-1528s1c1
Sequence:CCGGGCCTTTCGACTTTCCGTTATTCTCGAGAATAACGGAAAGTCGAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173870.1-1392s1c1
Sequence:CCGGCCCTCTTAAGAGCGACAGTTTCTCGAGAAACTGTCGCTCTTAAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173870.1-33s1c1
Sequence:CCGGGCTGGTATTTGTCACGTCCTTCTCGAGAAGGACGTGACAAATACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173870.1-247s1c1
Sequence:CCGGCTGAGTACAATCTCAGATAATCTCGAGATTATCTGAGATTGTACTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173870.1-829s1c1
Sequence:CCGGGCACTTCAACTTTCTTCGGAACTCGAGTTCCGAAGAAAGTTGAAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173870
MGAT4A MISSION shRNA shRNA Plasmid DNA
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173870.1-1528s1c1
Sequence:CCGGGCCTTTCGACTTTCCGTTATTCTCGAGAATAACGGAAAGTCGAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173870.1-1392s1c1
Sequence:CCGGCCCTCTTAAGAGCGACAGTTTCTCGAGAAACTGTCGCTCTTAAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173870.1-33s1c1
Sequence:CCGGGCTGGTATTTGTCACGTCCTTCTCGAGAAGGACGTGACAAATACCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173870.1-247s1c1
Sequence:CCGGCTGAGTACAATCTCAGATAATCTCGAGATTATCTGAGATTGTACTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173870.1-829s1c1
Sequence:CCGGGCACTTCAACTTTCTTCGGAACTCGAGTTCCGAAGAAAGTTGAAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173870
MGAT4A MISSION shRNA Lentiviral Transduction Particles
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173870.1-1528s1c1
Sequence:CCGGGCCTTTCGACTTTCCGTTATTCTCGAGAATAACGGAAAGTCGAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173870.1-1392s1c1
Sequence:CCGGCCCTCTTAAGAGCGACAGTTTCTCGAGAAACTGTCGCTCTTAAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173870.1-33s1c1
Sequence:CCGGGCTGGTATTTGTCACGTCCTTCTCGAGAAGGACGTGACAAATACCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173870.1-247s1c1
Sequence:CCGGCTGAGTACAATCTCAGATAATCTCGAGATTATCTGAGATTGTACTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173870.1-829s1c1
Sequence:CCGGGCACTTCAACTTTCTTCGGAACTCGAGTTCCGAAGAAAGTTGAAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012214
MGAT4A MISSION shRNA Bacterial Glycerol Stock
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012214.2-1754s21c1
Sequence:CCGGACGATTAGAAGATGGCTATTTCTCGAGAAATAGCCATCTTCTAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012214.1-1042s1c1
Sequence:CCGGCCGGATCTTACTCTGATTGTACTCGAGTACAATCAGAGTAAGATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012214.1-1441s1c1
Sequence:CCGGCCAGTCAATGTAGAAAGTTATCTCGAGATAACTTTCTACATTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012214.1-1702s1c1
Sequence:CCGGGCCATTCTTAATGAGATTCATCTCGAGATGAATCTCATTAAGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012214.1-521s1c1
Sequence:CCGGGCAACGGAAGAACAGGAGTTTCTCGAGAAACTCCTGTTCTTCCGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012214.1-703s1c1
Sequence:CCGGGCCAACCTGGAGAAAGAATTTCTCGAGAAATTCTTTCTCCAGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012214.2-1436s21c1
Sequence:CCGGACTCACGGATAAAGATTATATCTCGAGATATAATCTTTATCCGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012214
MGAT4A MISSION shRNA shRNA Plasmid DNA
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012214.2-1754s21c1
Sequence:CCGGACGATTAGAAGATGGCTATTTCTCGAGAAATAGCCATCTTCTAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012214.1-1042s1c1
Sequence:CCGGCCGGATCTTACTCTGATTGTACTCGAGTACAATCAGAGTAAGATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012214.1-1441s1c1
Sequence:CCGGCCAGTCAATGTAGAAAGTTATCTCGAGATAACTTTCTACATTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012214.1-1702s1c1
Sequence:CCGGGCCATTCTTAATGAGATTCATCTCGAGATGAATCTCATTAAGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012214.1-521s1c1
Sequence:CCGGGCAACGGAAGAACAGGAGTTTCTCGAGAAACTCCTGTTCTTCCGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012214.1-703s1c1
Sequence:CCGGGCCAACCTGGAGAAAGAATTTCTCGAGAAATTCTTTCTCCAGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012214.2-1436s21c1
Sequence:CCGGACTCACGGATAAAGATTATATCTCGAGATATAATCTTTATCCGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012214
MGAT4A MISSION shRNA Lentiviral Transduction Particles
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012214.2-1754s21c1
Sequence:CCGGACGATTAGAAGATGGCTATTTCTCGAGAAATAGCCATCTTCTAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012214.1-1042s1c1
Sequence:CCGGCCGGATCTTACTCTGATTGTACTCGAGTACAATCAGAGTAAGATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012214.1-1441s1c1
Sequence:CCGGCCAGTCAATGTAGAAAGTTATCTCGAGATAACTTTCTACATTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012214.1-1702s1c1
Sequence:CCGGGCCATTCTTAATGAGATTCATCTCGAGATGAATCTCATTAAGAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012214.1-521s1c1
Sequence:CCGGGCAACGGAAGAACAGGAGTTTCTCGAGAAACTCCTGTTCTTCCGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012214.1-703s1c1
Sequence:CCGGGCCAACCTGGAGAAAGAATTTCTCGAGAAATTCTTTCTCCAGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012214.2-1436s21c1
Sequence:CCGGACTCACGGATAAAGATTATATCTCGAGATATAATCTTTATCCGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)