EMAIL THIS PAGE TO A FRIEND

MGAT4B

mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B

86 Gene Product Result for
Synonyms: GNT-IV GNT-IVB
UniProtKB ID: Q9UQ53, A8MPR0, Q86TF1, Q96GH4, Q9NSK6
Gene ID:
Human(11282) Summary: This gene encodes a key glycosyltransferase that regulates the formation of tri- and multiantennary branching structures in the Golgi apparatus. The encoded protein, in addition to the related isoenzyme A, catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc in a beta-1,4 linkage to the Man-alpha-1,3-Man-beta-1,4-GlcNAc arm of R-Man-alpha-1,6(GlcNAc-beta-1,2-Man-alpha-1,3)Man-beta-1, 4-GlcNAc-beta-1,4-GlcNAc-beta-1-Asn. The encoded protein may play a role in regulating the availability of serum glycoproteins, oncogenesis, and differentiation. [provided by RefSeq, Jul 2008]
Mouse(103534) mannoside acetylglucosaminyltransferase 4, isoenzyme B
Rat(303100) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B
sheep(101119044) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B
Domestic Rabbit(100346059) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B
naked mole-rat(101723043) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B
domestic guinea pig(100725422) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B
Zebrafish(431727) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B
cow(526256) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B
Horse(100067257) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B
domestic cat(101095945) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B
dog(481458) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B
chicken(416285) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014275 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014275 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014275 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145926 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145926 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145926 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014275 Rosetta Predictions human pricing
NM_054013 Rosetta Predictions human pricing
NM_001127533 Rosetta Predictions rat pricing
NM_145926 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190064 predicted 1676
2 SASI_Hs02_00345345 predicted 1655
3 SASI_Hs01_00190065 predicted 1174
4 SASI_Hs02_00345346 predicted 1670
5 SASI_Hs02_00345347 predicted 1618
6 SASI_Hs01_00190068 predicted 1514
7 SASI_Hs01_00190069 predicted 919
8 SASI_Hs01_00190070 predicted 1095
9 SASI_Hs01_00190072 predicted 1110
10 SASI_Hs01_00190073 predicted 1084
11 SASI_Hs01_00190066 predicted 2417
12 SASI_Hs01_00190067 predicted 2409
13 SASI_Hs01_00190071 predicted 1294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020441 predicted 2326
2 SASI_Hs02_00361927 predicted 2298
3 SASI_Hs01_00020442 predicted 1816
4 SASI_Hs02_00361928 predicted 2317
5 SASI_Hs02_00361929 predicted 2269
6 SASI_Hs01_00020445 predicted 2165
7 SASI_Hs01_00020446 predicted 1571
8 SASI_Hs01_00020447 predicted 1736
9 SASI_Hs01_00020449 predicted 1759
10 SASI_Hs01_00020450 predicted 1728
11 SASI_Hs01_00020443 predicted 3059
12 SASI_Hs01_00020444 predicted 3057
13 SASI_Hs01_00020448 predicted 1942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127533 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254083 predicted 738
2 SASI_Rn02_00254084 predicted 1634
3 SASI_Rn02_00254085 predicted 1418
4 SASI_Rn02_00254086 predicted 1509
5 SASI_Rn02_00254087 predicted 1281
6 SASI_Rn02_00254088 predicted 1760
7 SASI_Rn02_00254089 predicted 994
8 SASI_Rn02_00254090 predicted 1615
9 SASI_Rn02_00254091 predicted 1072
10 SASI_Rn02_00254092 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145926 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165684 predicted 1305
2 SASI_Mm01_00165685 predicted 490
3 SASI_Mm01_00165686 predicted 1254
4 SASI_Mm01_00165687 predicted 1383
5 SASI_Mm01_00165688 predicted 1123
6 SASI_Mm01_00165689 predicted 1171
7 SASI_Mm01_00165690 predicted 1033
8 SASI_Mm01_00165691 predicted 740
9 SASI_Mm01_00165692 predicted 572
10 SASI_Mm01_00165693 predicted 824
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014275
MGAT4B MISSION shRNA Bacterial Glycerol Stock
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014275.4-465s21c1
Sequence:CCGGAGGCGACGTTGTGGACGTTTACTCGAGTAAACGTCCACAACGTCGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014275.4-1671s21c1
Sequence:CCGGCTTCATCCGCTTCCGCTTCTTCTCGAGAAGAAGCGGAAGCGGATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014275.4-2334s21c1
Sequence:CCGGTGGAATGCATATACTACTTTACTCGAGTAAAGTAGTATATGCATTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014275.2-979s1c1
Sequence:CCGGAGCCTGATTGTAGAGTTCATTCTCGAGAATGAACTCTACAATCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014275.2-810s1c1
Sequence:CCGGGCAGTCCAAAGGCATCTACTACTCGAGTAGTAGATGCCTTTGGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014275.2-1188s1c1
Sequence:CCGGGAAGGACAAAGACTTTGGAAACTCGAGTTTCCAAAGTCTTTGTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014275.2-1416s1c1
Sequence:CCGGCCCGGAGGACAAGCTCTTCAACTCGAGTTGAAGAGCTTGTCCTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014275.2-1657s1c1
Sequence:CCGGCTGAGCGAGATCTTCCTGAAACTCGAGTTTCAGGAAGATCTCGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014275
MGAT4B MISSION shRNA shRNA Plasmid DNA
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014275.4-465s21c1
Sequence:CCGGAGGCGACGTTGTGGACGTTTACTCGAGTAAACGTCCACAACGTCGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014275.4-1671s21c1
Sequence:CCGGCTTCATCCGCTTCCGCTTCTTCTCGAGAAGAAGCGGAAGCGGATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014275.4-2334s21c1
Sequence:CCGGTGGAATGCATATACTACTTTACTCGAGTAAAGTAGTATATGCATTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014275.2-979s1c1
Sequence:CCGGAGCCTGATTGTAGAGTTCATTCTCGAGAATGAACTCTACAATCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014275.2-810s1c1
Sequence:CCGGGCAGTCCAAAGGCATCTACTACTCGAGTAGTAGATGCCTTTGGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014275.2-1188s1c1
Sequence:CCGGGAAGGACAAAGACTTTGGAAACTCGAGTTTCCAAAGTCTTTGTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014275.2-1416s1c1
Sequence:CCGGCCCGGAGGACAAGCTCTTCAACTCGAGTTGAAGAGCTTGTCCTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014275.2-1657s1c1
Sequence:CCGGCTGAGCGAGATCTTCCTGAAACTCGAGTTTCAGGAAGATCTCGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014275
MGAT4B MISSION shRNA Lentiviral Transduction Particles
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014275.4-465s21c1
Sequence:CCGGAGGCGACGTTGTGGACGTTTACTCGAGTAAACGTCCACAACGTCGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014275.4-1671s21c1
Sequence:CCGGCTTCATCCGCTTCCGCTTCTTCTCGAGAAGAAGCGGAAGCGGATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014275.4-2334s21c1
Sequence:CCGGTGGAATGCATATACTACTTTACTCGAGTAAAGTAGTATATGCATTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014275.2-979s1c1
Sequence:CCGGAGCCTGATTGTAGAGTTCATTCTCGAGAATGAACTCTACAATCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014275.2-810s1c1
Sequence:CCGGGCAGTCCAAAGGCATCTACTACTCGAGTAGTAGATGCCTTTGGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014275.2-1188s1c1
Sequence:CCGGGAAGGACAAAGACTTTGGAAACTCGAGTTTCCAAAGTCTTTGTCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014275.2-1416s1c1
Sequence:CCGGCCCGGAGGACAAGCTCTTCAACTCGAGTTGAAGAGCTTGTCCTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014275.2-1657s1c1
Sequence:CCGGCTGAGCGAGATCTTCCTGAAACTCGAGTTTCAGGAAGATCTCGCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145926
VALIDATED
MGAT4B MISSION shRNA Bacterial Glycerol Stock
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145926.3-1335s21c1
Sequence:CCGGCCTGAGAAGGATGCGAAACATCTCGAGATGTTTCGCATCCTTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145926.3-1682s21c1
Sequence:CCGGCCCGGAAGATAAGCTCTTCAACTCGAGTTGAAGAGCTTATCTTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145926.3-776s21c1
Sequence:CCGGCTCGTACTTGACTGACACATTCTCGAGAATGTGTCAGTCAAGTACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145926.2-1384s1c1
Sequence:CCGGCCCGGAAGATAAGCTCTTCAACTCGAGTTGAAGAGCTTATCTTCCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145926.2-478s1c1
Sequence:CCGGCTCGTACTTGACTGACACATTCTCGAGAATGTGTCAGTCAAGTACGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145926.2-1037s1c1
Sequence:CCGGCCTGAGAAGGATGCGAAACATCTCGAGATGTTTCGCATCCTTCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145926.2-748s1c1
Sequence:CCGGCCTCGATTACTGCTTCCTCATCTCGAGATGAGGAAGCAGTAATCGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145926.3-1046s21c1
Sequence:CCGGCCTCGATTACTGCTTCCTCATCTCGAGATGAGGAAGCAGTAATCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145926.3-1526s21c1
Sequence:CCGGCCTCAAGACGTACCAGCATTTCTCGAGAAATGCTGGTACGTCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145926.2-1228s1c1
Sequence:CCGGCCTCAAGACGTACCAGCATTTCTCGAGAAATGCTGGTACGTCTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145926
VALIDATED
MGAT4B MISSION shRNA shRNA Plasmid DNA
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145926.3-1335s21c1
Sequence:CCGGCCTGAGAAGGATGCGAAACATCTCGAGATGTTTCGCATCCTTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145926.3-1682s21c1
Sequence:CCGGCCCGGAAGATAAGCTCTTCAACTCGAGTTGAAGAGCTTATCTTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145926.3-776s21c1
Sequence:CCGGCTCGTACTTGACTGACACATTCTCGAGAATGTGTCAGTCAAGTACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145926.2-1384s1c1
Sequence:CCGGCCCGGAAGATAAGCTCTTCAACTCGAGTTGAAGAGCTTATCTTCCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145926.2-478s1c1
Sequence:CCGGCTCGTACTTGACTGACACATTCTCGAGAATGTGTCAGTCAAGTACGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145926.2-1037s1c1
Sequence:CCGGCCTGAGAAGGATGCGAAACATCTCGAGATGTTTCGCATCCTTCTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145926.2-748s1c1
Sequence:CCGGCCTCGATTACTGCTTCCTCATCTCGAGATGAGGAAGCAGTAATCGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145926.3-1046s21c1
Sequence:CCGGCCTCGATTACTGCTTCCTCATCTCGAGATGAGGAAGCAGTAATCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145926.3-1526s21c1
Sequence:CCGGCCTCAAGACGTACCAGCATTTCTCGAGAAATGCTGGTACGTCTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145926.2-1228s1c1
Sequence:CCGGCCTCAAGACGTACCAGCATTTCTCGAGAAATGCTGGTACGTCTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145926
VALIDATED
MGAT4B MISSION shRNA Lentiviral Transduction Particles
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145926.3-1335s21c1
Sequence:CCGGCCTGAGAAGGATGCGAAACATCTCGAGATGTTTCGCATCCTTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145926.3-1682s21c1
Sequence:CCGGCCCGGAAGATAAGCTCTTCAACTCGAGTTGAAGAGCTTATCTTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145926.3-776s21c1
Sequence:CCGGCTCGTACTTGACTGACACATTCTCGAGAATGTGTCAGTCAAGTACGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145926.2-1384s1c1
Sequence:CCGGCCCGGAAGATAAGCTCTTCAACTCGAGTTGAAGAGCTTATCTTCCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145926.2-478s1c1
Sequence:CCGGCTCGTACTTGACTGACACATTCTCGAGAATGTGTCAGTCAAGTACGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145926.2-1037s1c1
Sequence:CCGGCCTGAGAAGGATGCGAAACATCTCGAGATGTTTCGCATCCTTCTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145926.2-748s1c1
Sequence:CCGGCCTCGATTACTGCTTCCTCATCTCGAGATGAGGAAGCAGTAATCGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145926.3-1046s21c1
Sequence:CCGGCCTCGATTACTGCTTCCTCATCTCGAGATGAGGAAGCAGTAATCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145926.3-1526s21c1
Sequence:CCGGCCTCAAGACGTACCAGCATTTCTCGAGAAATGCTGGTACGTCTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145926.2-1228s1c1
Sequence:CCGGCCTCAAGACGTACCAGCATTTCTCGAGAAATGCTGGTACGTCTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)