EMAIL THIS PAGE TO A FRIEND

MGAT4C

mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)

58 Gene Product Result for
Synonyms: GNTIVH HGNT-IV-H
UniProtKB ID: Q9UBM8, Q4G199, Q9UIU5
Gene ID:
Mouse(67569) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)
Rat(299756) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)
chicken(395415) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)
cow(539661) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)
Horse(100051064) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)
domestic cat(101096077) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)
dog(475418) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)
chicken(427873) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)
domestic guinea pig(100726416) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)
naked mole-rat(101725010) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)
sheep(101108733) mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013244 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013244 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013244 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026243 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026243 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026243 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054971 MISSION® esiRNA esiRNA human MGAT4C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013244 Rosetta Predictions human pricing
XM_001080664 Rosetta Predictions rat pricing
XM_235099 Rosetta Predictions rat pricing
NM_026243 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076642 predicted 629
2 SASI_Hs01_00076643 predicted 941
3 SASI_Hs01_00076645 predicted 1234
4 SASI_Hs01_00076646 predicted 1202
5 SASI_Hs01_00076647 predicted 761
6 SASI_Hs01_00076648 predicted 726
7 SASI_Hs01_00076649 predicted 811
8 SASI_Hs01_00076651 predicted 1131
9 SASI_Hs02_00344451 predicted 986
10 SASI_Hs02_00344452 predicted 738
11 SASI_Hs01_00076644 predicted 2017
12 SASI_Hs01_00076650 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080664 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368880 predicted 575
2 SASI_Rn02_00368881 predicted 442
3 SASI_Rn02_00368882 predicted 1213
4 SASI_Rn02_00368883 predicted 243
5 SASI_Rn02_00368884 predicted 509
6 SASI_Rn02_00368885 predicted 378
7 SASI_Rn02_00368886 predicted 821
8 SASI_Rn02_00368887 predicted 1026
9 SASI_Rn02_00368888 predicted 731
10 SASI_Rn02_00368889 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388995 predicted 527
2 SASI_Rn02_00388996 predicted 396
3 SASI_Rn02_00388997 predicted 1039
4 SASI_Rn02_00388998 predicted 1173
5 SASI_Rn02_00388999 predicted 192
6 SASI_Rn02_00389000 predicted 456
7 SASI_Rn02_00389001 predicted 330
8 SASI_Rn02_00389002 predicted 773
9 SASI_Rn02_00389003 predicted 982
10 SASI_Rn02_00389004 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329927 predicted 690
2 SASI_Mm01_00097927 predicted 980
3 SASI_Mm01_00097928 predicted 395
4 SASI_Mm02_00329928 predicted 955
5 SASI_Mm01_00097930 predicted 1295
6 SASI_Mm01_00097931 predicted 564
7 SASI_Mm02_00329929 predicted 944
8 SASI_Mm01_00097933 predicted 1328
9 SASI_Mm01_00097935 predicted 469
10 SASI_Mm01_00097936 predicted 1144
11 SASI_Mm01_00097929 predicted 1342
12 SASI_Mm01_00097932 predicted 373
13 SASI_Mm01_00097934 predicted 556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013244
MGAT4C MISSION shRNA Bacterial Glycerol Stock
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013244.2-1066s1c1
Sequence:CCGGCGCACCATATTATTGCAGGAACTCGAGTTCCTGCAATAATATGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013244.2-1698s1c1
Sequence:CCGGCCACCTTCAACAGGAGATGTTCTCGAGAACATCTCCTGTTGAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013244.2-1839s1c1
Sequence:CCGGCCTAGCAAACAAAGGAGACAACTCGAGTTGTCTCCTTTGTTTGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013244.2-660s1c1
Sequence:CCGGGTGTCATTCTTGGGAGTTCTTCTCGAGAAGAACTCCCAAGAATGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013244.2-1122s1c1
Sequence:CCGGCCAATCCTAGATGGCCTTAAACTCGAGTTTAAGGCCATCTAGGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013244.3-1867s21c1
Sequence:CCGGGGCTAATTATTAGGAGTATTACTCGAGTAATACTCCTAATAATTAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013244.3-1893s21c1
Sequence:CCGGTGGACTTCTTAGCCAATTAAACTCGAGTTTAATTGGCTAAGAAGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013244.3-1392s21c1
Sequence:CCGGTTTCAGCACATGGGCTATTATCTCGAGATAATAGCCCATGTGCTGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013244.3-983s21c1
Sequence:CCGGACATGCTCCAGAGGAGTATTACTCGAGTAATACTCCTCTGGAGCATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013244.3-1107s21c1
Sequence:CCGGGCCAATACTTCAGACTATTATCTCGAGATAATAGTCTGAAGTATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013244
MGAT4C MISSION shRNA shRNA Plasmid DNA
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013244.2-1066s1c1
Sequence:CCGGCGCACCATATTATTGCAGGAACTCGAGTTCCTGCAATAATATGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013244.2-1698s1c1
Sequence:CCGGCCACCTTCAACAGGAGATGTTCTCGAGAACATCTCCTGTTGAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013244.2-1839s1c1
Sequence:CCGGCCTAGCAAACAAAGGAGACAACTCGAGTTGTCTCCTTTGTTTGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013244.2-660s1c1
Sequence:CCGGGTGTCATTCTTGGGAGTTCTTCTCGAGAAGAACTCCCAAGAATGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013244.2-1122s1c1
Sequence:CCGGCCAATCCTAGATGGCCTTAAACTCGAGTTTAAGGCCATCTAGGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013244.3-1867s21c1
Sequence:CCGGGGCTAATTATTAGGAGTATTACTCGAGTAATACTCCTAATAATTAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013244.3-1893s21c1
Sequence:CCGGTGGACTTCTTAGCCAATTAAACTCGAGTTTAATTGGCTAAGAAGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013244.3-1392s21c1
Sequence:CCGGTTTCAGCACATGGGCTATTATCTCGAGATAATAGCCCATGTGCTGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013244.3-983s21c1
Sequence:CCGGACATGCTCCAGAGGAGTATTACTCGAGTAATACTCCTCTGGAGCATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013244.3-1107s21c1
Sequence:CCGGGCCAATACTTCAGACTATTATCTCGAGATAATAGTCTGAAGTATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013244
MGAT4C MISSION shRNA Lentiviral Transduction Particles
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013244.2-1066s1c1
Sequence:CCGGCGCACCATATTATTGCAGGAACTCGAGTTCCTGCAATAATATGGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013244.2-1698s1c1
Sequence:CCGGCCACCTTCAACAGGAGATGTTCTCGAGAACATCTCCTGTTGAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013244.2-1839s1c1
Sequence:CCGGCCTAGCAAACAAAGGAGACAACTCGAGTTGTCTCCTTTGTTTGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013244.2-660s1c1
Sequence:CCGGGTGTCATTCTTGGGAGTTCTTCTCGAGAAGAACTCCCAAGAATGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013244.2-1122s1c1
Sequence:CCGGCCAATCCTAGATGGCCTTAAACTCGAGTTTAAGGCCATCTAGGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013244.3-1867s21c1
Sequence:CCGGGGCTAATTATTAGGAGTATTACTCGAGTAATACTCCTAATAATTAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013244.3-1893s21c1
Sequence:CCGGTGGACTTCTTAGCCAATTAAACTCGAGTTTAATTGGCTAAGAAGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013244.3-1392s21c1
Sequence:CCGGTTTCAGCACATGGGCTATTATCTCGAGATAATAGCCCATGTGCTGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013244.3-983s21c1
Sequence:CCGGACATGCTCCAGAGGAGTATTACTCGAGTAATACTCCTCTGGAGCATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013244.3-1107s21c1
Sequence:CCGGGCCAATACTTCAGACTATTATCTCGAGATAATAGTCTGAAGTATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026243
MGAT4C MISSION shRNA Bacterial Glycerol Stock
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093824    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026243.2-2127s1c1
Sequence:CCGGGCTTTCACTGACTGATGAATTCTCGAGAATTCATCAGTCAGTGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026243.2-1416s1c1
Sequence:CCGGCGGCAGAATGACATCTTACAACTCGAGTTGTAAGATGTCATTCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026243.2-922s1c1
Sequence:CCGGCCATCAAGAAAGTCATAGCATCTCGAGATGCTATGACTTTCTTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026243.2-672s1c1
Sequence:CCGGGTCCAAGACATTACACAGAAACTCGAGTTTCTGTGTAATGTCTTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026243.2-401s1c1
Sequence:CCGGCCAACTTAATTCTGAACGCTACTCGAGTAGCGTTCAGAATTAAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026243
MGAT4C MISSION shRNA shRNA Plasmid DNA
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093824    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026243.2-2127s1c1
Sequence:CCGGGCTTTCACTGACTGATGAATTCTCGAGAATTCATCAGTCAGTGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026243.2-1416s1c1
Sequence:CCGGCGGCAGAATGACATCTTACAACTCGAGTTGTAAGATGTCATTCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026243.2-922s1c1
Sequence:CCGGCCATCAAGAAAGTCATAGCATCTCGAGATGCTATGACTTTCTTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026243.2-672s1c1
Sequence:CCGGGTCCAAGACATTACACAGAAACTCGAGTTTCTGTGTAATGTCTTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026243.2-401s1c1
Sequence:CCGGCCAACTTAATTCTGAACGCTACTCGAGTAGCGTTCAGAATTAAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026243
MGAT4C MISSION shRNA Lentiviral Transduction Particles
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093824    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026243.2-2127s1c1
Sequence:CCGGGCTTTCACTGACTGATGAATTCTCGAGAATTCATCAGTCAGTGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026243.2-1416s1c1
Sequence:CCGGCGGCAGAATGACATCTTACAACTCGAGTTGTAAGATGTCATTCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026243.2-922s1c1
Sequence:CCGGCCATCAAGAAAGTCATAGCATCTCGAGATGCTATGACTTTCTTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026243.2-672s1c1
Sequence:CCGGGTCCAAGACATTACACAGAAACTCGAGTTTCTGTGTAATGTCTTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026243.2-401s1c1
Sequence:CCGGCCAACTTAATTCTGAACGCTACTCGAGTAGCGTTCAGAATTAAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)