EMAIL THIS PAGE TO A FRIEND

MGAT5

mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase

50 Gene Product Result for
Synonyms: GNT-V GNT-VA
UniProtKB ID: Q09328, D3DP70
Gene ID:
Human(4249) Summary: The protein encoded by this gene belongs to the glycosyltransferase family. It catalyzes the addition of beta-1,6-N-acetylglucosamine to the alpha-linked mannose of biantennary N-linked oligosaccharides present on the newly synthesized glycoproteins. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. Alterations of the oligosaccharides on cell surface glycoproteins cause significant changes in the adhesive or migratory behavior of a cell. Increase in the activity of this enzyme has been correlated with the progression of invasive malignancies. [provided by RefSeq, Oct 2011]
Mouse(107895) mannoside acetylglucosaminyltransferase 5
Rat(65271) mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase
sheep(101107672) mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase
naked mole-rat(101721991) mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase
Domestic Rabbit(100346879) mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase
domestic guinea pig(100712879) mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase
Zebrafish(724006) mannoside acetylglucosaminyltransferase 5
chicken(424286) mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase
cow(537595) mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase
Horse(100050356) mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase
domestic cat(101088682) mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase
dog(483895) mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002410 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002410 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002410 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145128 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145128 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145128 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002410 Rosetta Predictions human pricing
NM_023095 Rosetta Predictions rat pricing
NM_145128 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079469 predicted 1529
2 SASI_Hs01_00079470 predicted 1277
3 SASI_Hs01_00079471 predicted 1305
4 SASI_Hs01_00079472 predicted 216
5 SASI_Hs01_00079474 predicted 1591
6 SASI_Hs01_00079475 predicted 1446
7 SASI_Hs01_00079476 predicted 1288
8 SASI_Hs01_00079477 predicted 978
9 SASI_Hs01_00079478 predicted 1576
10 SASI_Hs02_00333788 predicted 1179
11 SASI_Hs01_00079473 predicted 4532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074016 predicted 1929
2 SASI_Rn01_00074017 predicted 1680
3 SASI_Rn01_00074018 predicted 1198
4 SASI_Rn01_00074019 predicted 935
5 SASI_Rn01_00074020 predicted 1321
6 SASI_Rn01_00074021 predicted 1450
7 SASI_Rn01_00074022 predicted 2083
8 SASI_Rn01_00074023 predicted 1127
9 SASI_Rn01_00074024 predicted 2048
10 SASI_Rn01_00074025 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145128 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094052 predicted 2272
2 SASI_Mm02_00340515 predicted 708
3 SASI_Mm01_00094054 predicted 1268
4 SASI_Mm02_00340516 predicted 1649
5 SASI_Mm01_00094055 predicted 2382
6 SASI_Mm01_00094056 predicted 2416
7 SASI_Mm01_00094057 predicted 2020
8 SASI_Mm01_00094058 predicted 1219
9 SASI_Mm01_00094059 predicted 1408
10 SASI_Mm01_00094060 predicted 1604
11 SASI_Mm01_00094053 predicted 920
12 SASI_Mm01_00094061 predicted 1458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002410
VALIDATED
MGAT5 MISSION shRNA Bacterial Glycerol Stock
mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002410.3-790s21c1
Sequence:CCGGGGCGGAAATTCGTACAGATTTCTCGAGAAATCTGTACGAATTTCCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002410.3-1265s21c1
Sequence:CCGGCTCCGAGTCCTTGATTCATTTCTCGAGAAATGAATCAAGGACTCGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002410.3-1448s21c1
Sequence:CCGGAGTGATATCCACCACATTAATCTCGAGATTAATGTGGTGGATATCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002410.2-3952s1c1
Sequence:CCGGCCCGAATTTAATCATGCAAATCTCGAGATTTGCATGATTAAATTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002410.2-4879s1c1
Sequence:CCGGCCCTCCTTTGACCCTAAGAATCTCGAGATTCTTAGGGTCAAAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002410.2-4321s1c1
Sequence:CCGGCGAGAAACCAAGTTGTTTGTTCTCGAGAACAAACAACTTGGTTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002410.2-3022s1c1
Sequence:CCGGGCTGGAGTCATGACAGCTTATCTCGAGATAAGCTGTCATGACTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002410.2-3419s1c1
Sequence:CCGGCCTACGAAGAAGCTGATCATACTCGAGTATGATCAGCTTCTTCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002410
VALIDATED
MGAT5 MISSION shRNA shRNA Plasmid DNA
mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002410.3-790s21c1
Sequence:CCGGGGCGGAAATTCGTACAGATTTCTCGAGAAATCTGTACGAATTTCCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002410.3-1265s21c1
Sequence:CCGGCTCCGAGTCCTTGATTCATTTCTCGAGAAATGAATCAAGGACTCGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002410.3-1448s21c1
Sequence:CCGGAGTGATATCCACCACATTAATCTCGAGATTAATGTGGTGGATATCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002410.2-3952s1c1
Sequence:CCGGCCCGAATTTAATCATGCAAATCTCGAGATTTGCATGATTAAATTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002410.2-4879s1c1
Sequence:CCGGCCCTCCTTTGACCCTAAGAATCTCGAGATTCTTAGGGTCAAAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002410.2-4321s1c1
Sequence:CCGGCGAGAAACCAAGTTGTTTGTTCTCGAGAACAAACAACTTGGTTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002410.2-3022s1c1
Sequence:CCGGGCTGGAGTCATGACAGCTTATCTCGAGATAAGCTGTCATGACTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002410.2-3419s1c1
Sequence:CCGGCCTACGAAGAAGCTGATCATACTCGAGTATGATCAGCTTCTTCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002410
VALIDATED
MGAT5 MISSION shRNA Lentiviral Transduction Particles
mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002410.3-790s21c1
Sequence:CCGGGGCGGAAATTCGTACAGATTTCTCGAGAAATCTGTACGAATTTCCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002410.3-1265s21c1
Sequence:CCGGCTCCGAGTCCTTGATTCATTTCTCGAGAAATGAATCAAGGACTCGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002410.3-1448s21c1
Sequence:CCGGAGTGATATCCACCACATTAATCTCGAGATTAATGTGGTGGATATCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002410.2-3952s1c1
Sequence:CCGGCCCGAATTTAATCATGCAAATCTCGAGATTTGCATGATTAAATTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002410.2-4879s1c1
Sequence:CCGGCCCTCCTTTGACCCTAAGAATCTCGAGATTCTTAGGGTCAAAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002410.2-4321s1c1
Sequence:CCGGCGAGAAACCAAGTTGTTTGTTCTCGAGAACAAACAACTTGGTTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002410.2-3022s1c1
Sequence:CCGGGCTGGAGTCATGACAGCTTATCTCGAGATAAGCTGTCATGACTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002410.2-3419s1c1
Sequence:CCGGCCTACGAAGAAGCTGATCATACTCGAGTATGATCAGCTTCTTCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145128
MGAT5 MISSION shRNA Bacterial Glycerol Stock
mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145128.2-627s1c1
Sequence:CCGGCCCTATGAAGAAGCTGATCATCTCGAGATGATCAGCTTCTTCATAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145128.2-1799s1c1
Sequence:CCGGCCAGAAGATTGAGCCGTATATCTCGAGATATACGGCTCAATCTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145128.2-2216s1c1
Sequence:CCGGCCTCTGCAAAGACTGCCTATACTCGAGTATAGGCAGTCTTTGCAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145128.2-414s1c1
Sequence:CCGGGCAGATATCATTAATGGAGTTCTCGAGAACTCCATTAATGATATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145128.2-1850s1c1
Sequence:CCGGGCAGAGAATCAACGCTTTCATCTCGAGATGAAAGCGTTGATTCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145128
MGAT5 MISSION shRNA shRNA Plasmid DNA
mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145128.2-627s1c1
Sequence:CCGGCCCTATGAAGAAGCTGATCATCTCGAGATGATCAGCTTCTTCATAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145128.2-1799s1c1
Sequence:CCGGCCAGAAGATTGAGCCGTATATCTCGAGATATACGGCTCAATCTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145128.2-2216s1c1
Sequence:CCGGCCTCTGCAAAGACTGCCTATACTCGAGTATAGGCAGTCTTTGCAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145128.2-414s1c1
Sequence:CCGGGCAGATATCATTAATGGAGTTCTCGAGAACTCCATTAATGATATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145128.2-1850s1c1
Sequence:CCGGGCAGAGAATCAACGCTTTCATCTCGAGATGAAAGCGTTGATTCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145128
MGAT5 MISSION shRNA Lentiviral Transduction Particles
mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145128.2-627s1c1
Sequence:CCGGCCCTATGAAGAAGCTGATCATCTCGAGATGATCAGCTTCTTCATAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145128.2-1799s1c1
Sequence:CCGGCCAGAAGATTGAGCCGTATATCTCGAGATATACGGCTCAATCTTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145128.2-2216s1c1
Sequence:CCGGCCTCTGCAAAGACTGCCTATACTCGAGTATAGGCAGTCTTTGCAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145128.2-414s1c1
Sequence:CCGGGCAGATATCATTAATGGAGTTCTCGAGAACTCCATTAATGATATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145128.2-1850s1c1
Sequence:CCGGGCAGAGAATCAACGCTTTCATCTCGAGATGAAAGCGTTGATTCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)