EMAIL THIS PAGE TO A FRIEND

MGAT5B

mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B

75 Gene Product Result for
Synonyms: GnT-IX GnT-VB
UniProtKB ID: Q3V5L5, Q6P3S8, Q6P6B3, Q766X5, Q76D04, Q96LS2
Gene ID:
Human(146664) Summary: The MGAT5B gene encodes a beta-1,6-N-acetylglucosaminyltransferase (EC 2.4.1.155) that functions in the synthesis of complex cell surface N-glycans (Kaneko et al., 2003 [PubMed 14623122]
Mouse(268510) mannoside acetylglucosaminyltransferase 5, isoenzyme B
Rat(303693) mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B
chicken(427801) mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B
cow(785213) mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B
Horse(100058438) mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B
domestic cat(101087025) mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B
dog(483337) mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B
domestic guinea pig(100723796) mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B
naked mole-rat(101721905) mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B
sheep(101115810) mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144677 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144677 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144677 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172948 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172948 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172948 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144677 Rosetta Predictions human pricing
NM_198955 Rosetta Predictions human pricing
NM_001107068 Rosetta Predictions rat pricing
NM_172948 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127947 predicted 2423
2 SASI_Hs02_00364578 predicted 1264
3 SASI_Hs01_00127948 predicted 1441
4 SASI_Hs01_00127949 predicted 1879
5 SASI_Hs01_00127950 predicted 3058
6 SASI_Hs01_00127951 predicted 2762
7 SASI_Hs01_00127952 predicted 1034
8 SASI_Hs01_00127953 predicted 1652
9 SASI_Hs01_00127954 predicted 2085
10 SASI_Hs01_00127955 predicted 1469
11 SASI_Hs01_00127956 predicted 1581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066207 predicted 2251
2 SASI_Hs02_00372468 predicted 1092
3 SASI_Hs01_00066208 predicted 1260
4 SASI_Hs01_00066209 predicted 1707
5 SASI_Hs01_00066210 predicted 2883
6 SASI_Hs01_00066211 predicted 2591
7 SASI_Hs01_00066212 predicted 850
8 SASI_Hs01_00066213 predicted 1476
9 SASI_Hs01_00066214 predicted 1901
10 SASI_Hs01_00066215 predicted 1289
11 SASI_Hs01_00066216 predicted 1412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107068 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225176 predicted 1284
2 SASI_Rn02_00225177 predicted 2177
3 SASI_Rn02_00225178 predicted 2136
4 SASI_Rn02_00225179 predicted 2082
5 SASI_Rn02_00225180 predicted 2220
6 SASI_Rn02_00225181 predicted 1530
7 SASI_Rn02_00225182 predicted 2581
8 SASI_Rn02_00225183 predicted 2104
9 SASI_Rn02_00225184 predicted 1142
10 SASI_Rn02_00225185 predicted 2226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172948 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113552 predicted 2435
2 SASI_Mm02_00344981 predicted 2508
3 SASI_Mm01_00113553 predicted 2422
4 SASI_Mm01_00113554 predicted 2863
5 SASI_Mm01_00113555 predicted 2733
6 SASI_Mm02_00344982 predicted 2460
7 SASI_Mm01_00113557 predicted 646
8 SASI_Mm01_00113558 predicted 987
9 SASI_Mm01_00113559 predicted 2194
10 SASI_Mm02_00344983 predicted 2193
11 SASI_Mm01_00113550 predicted 1444
12 SASI_Mm01_00113551 predicted 2474
13 SASI_Mm01_00113556 predicted 1571
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144677
VALIDATED
MGAT5B MISSION shRNA Bacterial Glycerol Stock
mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144677.2-1887s1c1
Sequence:CCGGGCCAAACTCTTCATCGGGTTTCTCGAGAAACCCGATGAAGAGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_144677.2-2139s1c1
Sequence:CCGGGCCATTATGAGAACTCAGGTACTCGAGTACCTGAGTTCTCATAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144677.2-1751s1c1
Sequence:CCGGCCTGGGCATCCTGAACAAATACTCGAGTATTTGTTCAGGATGCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_144677.2-1445s1c1
Sequence:CCGGCATGGGACTCTCCTTCAAGAACTCGAGTTCTTGAAGGAGAGTCCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_144677.2-695s1c1
Sequence:CCGGCGTCTCCGACATCGCTGTGAACTCGAGTTCACAGCGATGTCGGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144677.2-3072s21c1
Sequence:CCGGAGACTTGCAAGGGAGAGGAACCTCGAGGTTCCTCTCCCTTGCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144677.2-1585s21c1
Sequence:CCGGAGCAGTTCATGACCATGTTTCCTCGAGGAAACATGGTCATGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144677.2-1270s21c1
Sequence:CCGGACATTCTGACTGCACTCTATGCTCGAGCATAGAGTGCAGTCAGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144677.2-1445s21c1
Sequence:CCGGCATGGGACTCTCCTTCAAGAACTCGAGTTCTTGAAGGAGAGTCCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144677.2-2139s21c1
Sequence:CCGGGCCATTATGAGAACTCAGGTACTCGAGTACCTGAGTTCTCATAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144677
VALIDATED
MGAT5B MISSION shRNA shRNA Plasmid DNA
mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144677.2-1887s1c1
Sequence:CCGGGCCAAACTCTTCATCGGGTTTCTCGAGAAACCCGATGAAGAGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_144677.2-2139s1c1
Sequence:CCGGGCCATTATGAGAACTCAGGTACTCGAGTACCTGAGTTCTCATAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144677.2-1751s1c1
Sequence:CCGGCCTGGGCATCCTGAACAAATACTCGAGTATTTGTTCAGGATGCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_144677.2-1445s1c1
Sequence:CCGGCATGGGACTCTCCTTCAAGAACTCGAGTTCTTGAAGGAGAGTCCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_144677.2-695s1c1
Sequence:CCGGCGTCTCCGACATCGCTGTGAACTCGAGTTCACAGCGATGTCGGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144677.2-3072s21c1
Sequence:CCGGAGACTTGCAAGGGAGAGGAACCTCGAGGTTCCTCTCCCTTGCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144677.2-1585s21c1
Sequence:CCGGAGCAGTTCATGACCATGTTTCCTCGAGGAAACATGGTCATGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144677.2-1270s21c1
Sequence:CCGGACATTCTGACTGCACTCTATGCTCGAGCATAGAGTGCAGTCAGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144677.2-1445s21c1
Sequence:CCGGCATGGGACTCTCCTTCAAGAACTCGAGTTCTTGAAGGAGAGTCCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144677.2-2139s21c1
Sequence:CCGGGCCATTATGAGAACTCAGGTACTCGAGTACCTGAGTTCTCATAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144677
VALIDATED
MGAT5B MISSION shRNA Lentiviral Transduction Particles
mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144677.2-1887s1c1
Sequence:CCGGGCCAAACTCTTCATCGGGTTTCTCGAGAAACCCGATGAAGAGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_144677.2-2139s1c1
Sequence:CCGGGCCATTATGAGAACTCAGGTACTCGAGTACCTGAGTTCTCATAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144677.2-1751s1c1
Sequence:CCGGCCTGGGCATCCTGAACAAATACTCGAGTATTTGTTCAGGATGCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_144677.2-1445s1c1
Sequence:CCGGCATGGGACTCTCCTTCAAGAACTCGAGTTCTTGAAGGAGAGTCCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_144677.2-695s1c1
Sequence:CCGGCGTCTCCGACATCGCTGTGAACTCGAGTTCACAGCGATGTCGGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144677.2-3072s21c1
Sequence:CCGGAGACTTGCAAGGGAGAGGAACCTCGAGGTTCCTCTCCCTTGCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144677.2-1585s21c1
Sequence:CCGGAGCAGTTCATGACCATGTTTCCTCGAGGAAACATGGTCATGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144677.2-1270s21c1
Sequence:CCGGACATTCTGACTGCACTCTATGCTCGAGCATAGAGTGCAGTCAGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144677.2-1445s21c1
Sequence:CCGGCATGGGACTCTCCTTCAAGAACTCGAGTTCTTGAAGGAGAGTCCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144677.2-2139s21c1
Sequence:CCGGGCCATTATGAGAACTCAGGTACTCGAGTACCTGAGTTCTCATAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172948
MGAT5B MISSION shRNA Bacterial Glycerol Stock
mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172948.3-3360s1c1
Sequence:CCGGCCTATTCACCAGAGGTCTCAACTCGAGTTGAGACCTCTGGTGAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172948.3-2197s1c1
Sequence:CCGGGCTCTTTATAGGGTTCGGATTCTCGAGAATCCGAACCCTATAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172948.3-2831s1c1
Sequence:CCGGCATCACTTGTACCCTGCCTTTCTCGAGAAAGGCAGGGTACAAGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172948.3-1697s1c1
Sequence:CCGGGACCTCATCTACACGGACTATCTCGAGATAGTCCGTGTAGATGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172948.3-2591s1c1
Sequence:CCGGCCATTTGTCTTAGCTCCTAATCTCGAGATTAGGAGCTAAGACAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172948.3-854s21c1
Sequence:CCGGATGGTGAAGCGCATGGATATGCTCGAGCATATCCATGCGCTTCACCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172948.3-2392s21c1
Sequence:CCGGCGTGTGGACCGTGGACTATAACTCGAGTTATAGTCCACGGTCCACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172948.3-1812s21c1
Sequence:CCGGCGTACAACCACGAGGAGTATGCTCGAGCATACTCCTCGTGGTTGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172948
MGAT5B MISSION shRNA shRNA Plasmid DNA
mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172948.3-3360s1c1
Sequence:CCGGCCTATTCACCAGAGGTCTCAACTCGAGTTGAGACCTCTGGTGAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172948.3-2197s1c1
Sequence:CCGGGCTCTTTATAGGGTTCGGATTCTCGAGAATCCGAACCCTATAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172948.3-2831s1c1
Sequence:CCGGCATCACTTGTACCCTGCCTTTCTCGAGAAAGGCAGGGTACAAGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172948.3-1697s1c1
Sequence:CCGGGACCTCATCTACACGGACTATCTCGAGATAGTCCGTGTAGATGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172948.3-2591s1c1
Sequence:CCGGCCATTTGTCTTAGCTCCTAATCTCGAGATTAGGAGCTAAGACAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172948.3-854s21c1
Sequence:CCGGATGGTGAAGCGCATGGATATGCTCGAGCATATCCATGCGCTTCACCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172948.3-2392s21c1
Sequence:CCGGCGTGTGGACCGTGGACTATAACTCGAGTTATAGTCCACGGTCCACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172948.3-1812s21c1
Sequence:CCGGCGTACAACCACGAGGAGTATGCTCGAGCATACTCCTCGTGGTTGTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172948
MGAT5B MISSION shRNA Lentiviral Transduction Particles
mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172948.3-3360s1c1
Sequence:CCGGCCTATTCACCAGAGGTCTCAACTCGAGTTGAGACCTCTGGTGAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172948.3-2197s1c1
Sequence:CCGGGCTCTTTATAGGGTTCGGATTCTCGAGAATCCGAACCCTATAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172948.3-2831s1c1
Sequence:CCGGCATCACTTGTACCCTGCCTTTCTCGAGAAAGGCAGGGTACAAGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172948.3-1697s1c1
Sequence:CCGGGACCTCATCTACACGGACTATCTCGAGATAGTCCGTGTAGATGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172948.3-2591s1c1
Sequence:CCGGCCATTTGTCTTAGCTCCTAATCTCGAGATTAGGAGCTAAGACAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172948.3-854s21c1
Sequence:CCGGATGGTGAAGCGCATGGATATGCTCGAGCATATCCATGCGCTTCACCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172948.3-2392s21c1
Sequence:CCGGCGTGTGGACCGTGGACTATAACTCGAGTTATAGTCCACGGTCCACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172948.3-1812s21c1
Sequence:CCGGCGTACAACCACGAGGAGTATGCTCGAGCATACTCCTCGTGGTTGTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)