EMAIL THIS PAGE TO A FRIEND

MGC13053

41 Gene Product Result for
Species: Human MGC13053(84796)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032710 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032710
MGC13053 MISSION shRNA Bacterial Glycerol Stock
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166498    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032710.1-1792s1c1
Sequence:CCGGCGCCTGTAATCCCAGTACTTTCTCGAGAAAGTACTGGGATTACAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032710.1-973s1c1
Sequence:CCGGGCAGCAGAAAGAAGGAAGAATCTCGAGATTCTTCCTTCTTTCTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032710.1-463s1c1
Sequence:CCGGGCAATACACAGAACAAGATTCCTCGAGGAATCTTGTTCTGTGTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160912    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032710.1-1281s1c1
Sequence:CCGGGCTAGTAAGTAGAAGTGCTAACTCGAGTTAGCACTTCTACTTACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159376    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032710.1-1105s1c1
Sequence:CCGGGCAAGTCAGAATTTGGTTTATCTCGAGATAAACCAAATTCTGACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032710.1-473s1c1
Sequence:CCGGGAACAAGATTCCGTTGTTACACTCGAGTGTAACAACGGAATCTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032710.1-471s1c1
Sequence:CCGGCAGAACAAGATTCCGTTGTTACTCGAGTAACAACGGAATCTTGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032710.1-469s1c1
Sequence:CCGGCACAGAACAAGATTCCGTTGTCTCGAGACAACGGAATCTTGTTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032710.1-456s1c1
Sequence:CCGGGCACAACGCAATACACAGAACCTCGAGGTTCTGTGTATTGCGTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032710
MGC13053 MISSION shRNA shRNA Plasmid DNA
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166498    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032710.1-1792s1c1
Sequence:CCGGCGCCTGTAATCCCAGTACTTTCTCGAGAAAGTACTGGGATTACAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032710.1-973s1c1
Sequence:CCGGGCAGCAGAAAGAAGGAAGAATCTCGAGATTCTTCCTTCTTTCTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032710.1-463s1c1
Sequence:CCGGGCAATACACAGAACAAGATTCCTCGAGGAATCTTGTTCTGTGTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160912    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032710.1-1281s1c1
Sequence:CCGGGCTAGTAAGTAGAAGTGCTAACTCGAGTTAGCACTTCTACTTACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159376    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032710.1-1105s1c1
Sequence:CCGGGCAAGTCAGAATTTGGTTTATCTCGAGATAAACCAAATTCTGACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032710.1-473s1c1
Sequence:CCGGGAACAAGATTCCGTTGTTACACTCGAGTGTAACAACGGAATCTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032710.1-471s1c1
Sequence:CCGGCAGAACAAGATTCCGTTGTTACTCGAGTAACAACGGAATCTTGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032710.1-469s1c1
Sequence:CCGGCACAGAACAAGATTCCGTTGTCTCGAGACAACGGAATCTTGTTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032710.1-456s1c1
Sequence:CCGGGCACAACGCAATACACAGAACCTCGAGGTTCTGTGTATTGCGTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032710
MGC13053 MISSION shRNA Lentiviral Transduction Particles
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166498    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032710.1-1792s1c1
Sequence:CCGGCGCCTGTAATCCCAGTACTTTCTCGAGAAAGTACTGGGATTACAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032710.1-973s1c1
Sequence:CCGGGCAGCAGAAAGAAGGAAGAATCTCGAGATTCTTCCTTCTTTCTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032710.1-463s1c1
Sequence:CCGGGCAATACACAGAACAAGATTCCTCGAGGAATCTTGTTCTGTGTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160912    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032710.1-1281s1c1
Sequence:CCGGGCTAGTAAGTAGAAGTGCTAACTCGAGTTAGCACTTCTACTTACTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159376    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032710.1-1105s1c1
Sequence:CCGGGCAAGTCAGAATTTGGTTTATCTCGAGATAAACCAAATTCTGACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032710.1-473s1c1
Sequence:CCGGGAACAAGATTCCGTTGTTACACTCGAGTGTAACAACGGAATCTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032710.1-471s1c1
Sequence:CCGGCAGAACAAGATTCCGTTGTTACTCGAGTAACAACGGAATCTTGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032710.1-469s1c1
Sequence:CCGGCACAGAACAAGATTCCGTTGTCTCGAGACAACGGAATCTTGTTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032710.1-456s1c1
Sequence:CCGGGCACAACGCAATACACAGAACCTCGAGGTTCTGTGTATTGCGTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)