EMAIL THIS PAGE TO A FRIEND

MGC21881

163 Gene Product Result for
Species: Human MGC21881(389741)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203448 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203448 Rosetta Predictions human pricing
NR_015363 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082659 predicted 406
2 SASI_Hs01_00082660 predicted 399
3 SASI_Hs01_00082661 predicted 410
4 SASI_Hs01_00082662 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_015363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381232 predicted 805
2 SASI_Hs02_00381233 predicted 1866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203448
MGC21881 MISSION shRNA Bacterial Glycerol Stock
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203448.1-323s1c1
Sequence:CCGGGAATCCACCCATTGCTCGTTTCTCGAGAAACGAGCAATGGGTGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203448.1-400s1c1
Sequence:CCGGGAGACGCCTCCTCGATTAAATCTCGAGATTTAATCGAGGAGGCGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160010    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203448.1-518s1c1
Sequence:CCGGCCTCACAGTTAATTATCGATTCTCGAGAATCGATAATTAACTGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164633    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203448.1-917s1c1
Sequence:CCGGCGTGTGACCTTGGTTAAGATACTCGAGTATCTTAACCAAGGTCACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203448.1-406s1c1
Sequence:CCGGCCTCCTCGATTAAATGCTGTTCTCGAGAACAGCATTTAATCGAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188055    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203448.1-1082s1c1
Sequence:CCGGCGTCCTTAGTAAACTGAGGTACTCGAGTACCTCAGTTTACTAAGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187258    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203448.1-828s1c1
Sequence:CCGGCCAGTAAAGCAGAGAGGTTAACTCGAGTTAACCTCTCTGCTTTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203448.1-407s1c1
Sequence:CCGGCTCCTCGATTAAATGCTGTTTCTCGAGAAACAGCATTTAATCGAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203448
MGC21881 MISSION shRNA shRNA Plasmid DNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203448.1-323s1c1
Sequence:CCGGGAATCCACCCATTGCTCGTTTCTCGAGAAACGAGCAATGGGTGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203448.1-400s1c1
Sequence:CCGGGAGACGCCTCCTCGATTAAATCTCGAGATTTAATCGAGGAGGCGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160010    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203448.1-518s1c1
Sequence:CCGGCCTCACAGTTAATTATCGATTCTCGAGAATCGATAATTAACTGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164633    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203448.1-917s1c1
Sequence:CCGGCGTGTGACCTTGGTTAAGATACTCGAGTATCTTAACCAAGGTCACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203448.1-406s1c1
Sequence:CCGGCCTCCTCGATTAAATGCTGTTCTCGAGAACAGCATTTAATCGAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188055    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203448.1-1082s1c1
Sequence:CCGGCGTCCTTAGTAAACTGAGGTACTCGAGTACCTCAGTTTACTAAGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187258    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203448.1-828s1c1
Sequence:CCGGCCAGTAAAGCAGAGAGGTTAACTCGAGTTAACCTCTCTGCTTTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203448.1-407s1c1
Sequence:CCGGCTCCTCGATTAAATGCTGTTTCTCGAGAAACAGCATTTAATCGAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203448
MGC21881 MISSION shRNA Lentiviral Transduction Particles
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203448.1-323s1c1
Sequence:CCGGGAATCCACCCATTGCTCGTTTCTCGAGAAACGAGCAATGGGTGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203448.1-400s1c1
Sequence:CCGGGAGACGCCTCCTCGATTAAATCTCGAGATTTAATCGAGGAGGCGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160010    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203448.1-518s1c1
Sequence:CCGGCCTCACAGTTAATTATCGATTCTCGAGAATCGATAATTAACTGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164633    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203448.1-917s1c1
Sequence:CCGGCGTGTGACCTTGGTTAAGATACTCGAGTATCTTAACCAAGGTCACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203448.1-406s1c1
Sequence:CCGGCCTCCTCGATTAAATGCTGTTCTCGAGAACAGCATTTAATCGAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188055    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203448.1-1082s1c1
Sequence:CCGGCGTCCTTAGTAAACTGAGGTACTCGAGTACCTCAGTTTACTAAGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187258    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203448.1-828s1c1
Sequence:CCGGCCAGTAAAGCAGAGAGGTTAACTCGAGTTAACCTCTCTGCTTTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203448.1-407s1c1
Sequence:CCGGCTCCTCGATTAAATGCTGTTTCTCGAGAAACAGCATTTAATCGAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)