EMAIL THIS PAGE TO A FRIEND

MGC2752

65 Gene Product Result for
Species: Human MGC2752(65996)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023939 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023939 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023939 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023939 Rosetta Predictions human pricing
XR_039990 Rosetta Predictions human pricing
XR_039991 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084379 predicted 1872
2 SASI_Hs01_00084380 predicted 1828
3 SASI_Hs01_00084381 predicted 1925
4 SASI_Hs01_00084382 predicted 1647
5 SASI_Hs01_00084383 predicted 1748
6 SASI_Hs01_00084384 predicted 1885
7 SASI_Hs01_00084385 predicted 1730
8 SASI_Hs01_00084386 predicted 1637
9 SASI_Hs01_00084387 predicted 1696
10 SASI_Hs01_00084388 predicted 1701
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514931 predicted 2264
2 SASI_Hs02_00514932 predicted 282
3 SASI_Hs02_00514933 predicted 2308
4 SASI_Hs02_00514934 predicted 2128
5 SASI_Hs02_00514935 predicted 2421
6 SASI_Hs02_00514936 predicted 2408
7 SASI_Hs02_00514937 predicted 1564
8 SASI_Hs02_00514938 predicted 2321
9 SASI_Hs02_00514939 predicted 2425
10 SASI_Hs02_00514940 predicted 1626
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514941 predicted 312
2 SASI_Hs02_00514942 predicted 2404
3 SASI_Hs02_00514943 predicted 421
4 SASI_Hs02_00514944 predicted 1662
5 SASI_Hs02_00514945 predicted 2457
6 SASI_Hs02_00514946 predicted 2281
7 SASI_Hs02_00514947 predicted 268
8 SASI_Hs02_00514948 predicted 2310
9 SASI_Hs02_00514949 predicted 2568
10 SASI_Hs02_00514950 predicted 300
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023939
MGC2752 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023939.3-1634s1c1
Sequence:CCGGGACGCTTCCATGAACTCTCAACTCGAGTTGAGAGTTCATGGAAGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023939.3-2728s1c1
Sequence:CCGGCCTCAGATAATGTGCATGTGACTCGAGTCACATGCACATTATCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023939.3-2908s1c1
Sequence:CCGGCAGAGTTGGATGAGAAATCAACTCGAGTTGATTTCTCATCCAACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023939.3-1856s1c1
Sequence:CCGGGTTCACATTTCCACTGACCTTCTCGAGAAGGTCAGTGGAAATGTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023939.3-2718s1c1
Sequence:CCGGCCAGACCTAACCTCAGATAATCTCGAGATTATCTGAGGTTAGGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023939
MGC2752 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023939.3-1634s1c1
Sequence:CCGGGACGCTTCCATGAACTCTCAACTCGAGTTGAGAGTTCATGGAAGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023939.3-2728s1c1
Sequence:CCGGCCTCAGATAATGTGCATGTGACTCGAGTCACATGCACATTATCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023939.3-2908s1c1
Sequence:CCGGCAGAGTTGGATGAGAAATCAACTCGAGTTGATTTCTCATCCAACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023939.3-1856s1c1
Sequence:CCGGGTTCACATTTCCACTGACCTTCTCGAGAAGGTCAGTGGAAATGTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023939.3-2718s1c1
Sequence:CCGGCCAGACCTAACCTCAGATAATCTCGAGATTATCTGAGGTTAGGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023939
MGC2752 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023939.3-1634s1c1
Sequence:CCGGGACGCTTCCATGAACTCTCAACTCGAGTTGAGAGTTCATGGAAGCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023939.3-2728s1c1
Sequence:CCGGCCTCAGATAATGTGCATGTGACTCGAGTCACATGCACATTATCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023939.3-2908s1c1
Sequence:CCGGCAGAGTTGGATGAGAAATCAACTCGAGTTGATTTCTCATCCAACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023939.3-1856s1c1
Sequence:CCGGGTTCACATTTCCACTGACCTTCTCGAGAAGGTCAGTGGAAATGTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023939.3-2718s1c1
Sequence:CCGGCCAGACCTAACCTCAGATAATCTCGAGATTATCTGAGGTTAGGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)