EMAIL THIS PAGE TO A FRIEND

MGC34034

Gene Product Result for
Species: Human MGC34034(154089)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153224
MGC34034 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000128711    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153224.2-768s1c1
Sequence:CCGGCGATGGTACTTCTTAGAGATACTCGAGTATCTCTAAGAAGTACCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153224.2-670s1c1
Sequence:CCGGCCAGTTGACTTAAGAACACTTCTCGAGAAGTGTTCTTAAGTCAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153224.2-363s1c1
Sequence:CCGGCTTCATCTCATCATCCAACATCTCGAGATGTTGGATGATGAGATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153224.2-3277s1c1
Sequence:CCGGGCAAATGTTTAGGGAGGGAAACTCGAGTTTCCCTCCCTAAACATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153224.2-767s1c1
Sequence:CCGGCCGATGGTACTTCTTAGAGATCTCGAGATCTCTAAGAAGTACCATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153224
MGC34034 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000128711    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153224.2-768s1c1
Sequence:CCGGCGATGGTACTTCTTAGAGATACTCGAGTATCTCTAAGAAGTACCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153224.2-670s1c1
Sequence:CCGGCCAGTTGACTTAAGAACACTTCTCGAGAAGTGTTCTTAAGTCAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153224.2-363s1c1
Sequence:CCGGCTTCATCTCATCATCCAACATCTCGAGATGTTGGATGATGAGATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153224.2-3277s1c1
Sequence:CCGGGCAAATGTTTAGGGAGGGAAACTCGAGTTTCCCTCCCTAAACATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153224.2-767s1c1
Sequence:CCGGCCGATGGTACTTCTTAGAGATCTCGAGATCTCTAAGAAGTACCATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153224
MGC34034 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000128711    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153224.2-768s1c1
Sequence:CCGGCGATGGTACTTCTTAGAGATACTCGAGTATCTCTAAGAAGTACCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153224.2-670s1c1
Sequence:CCGGCCAGTTGACTTAAGAACACTTCTCGAGAAGTGTTCTTAAGTCAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153224.2-363s1c1
Sequence:CCGGCTTCATCTCATCATCCAACATCTCGAGATGTTGGATGATGAGATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153224.2-3277s1c1
Sequence:CCGGGCAAATGTTTAGGGAGGGAAACTCGAGTTTCCCTCCCTAAACATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153224.2-767s1c1
Sequence:CCGGCCGATGGTACTTCTTAGAGATCTCGAGATCTCTAAGAAGTACCATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)