EMAIL THIS PAGE TO A FRIEND

MGC39545

30 Gene Product Result for
Species: Human MGC39545(403312)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203452 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_017796 Rosetta Predictions human pricing
XR_017799 Rosetta Predictions human pricing
XR_041651 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017796 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494578 predicted 272
2 SASI_Hs02_00494579 predicted 443
3 SASI_Hs02_00494580 predicted 268
4 SASI_Hs02_00494581 predicted 423
5 SASI_Hs02_00494582 predicted 451
6 SASI_Hs02_00494583 predicted 483
7 SASI_Hs02_00494584 predicted 318
8 SASI_Hs02_00494585 predicted 427
9 SASI_Hs02_00494586 predicted 318
10 SASI_Hs02_00494587 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494608 predicted 274
2 SASI_Hs02_00494609 predicted 443
3 SASI_Hs02_00494610 predicted 269
4 SASI_Hs02_00494611 predicted 415
5 SASI_Hs02_00494612 predicted 442
6 SASI_Hs02_00494613 predicted 480
7 SASI_Hs02_00494614 predicted 312
8 SASI_Hs02_00494615 predicted 423
9 SASI_Hs02_00494616 predicted 319
10 SASI_Hs02_00494617 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529229 predicted 270
2 SASI_Hs02_00529230 predicted 444
3 SASI_Hs02_00529231 predicted 272
4 SASI_Hs02_00529232 predicted 418
5 SASI_Hs02_00529233 predicted 448
6 SASI_Hs02_00529234 predicted 480
7 SASI_Hs02_00529235 predicted 320
8 SASI_Hs02_00529236 predicted 423
9 SASI_Hs02_00529237 predicted 318
10 SASI_Hs02_00529238 predicted 430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203452
MGC39545 MISSION shRNA Bacterial Glycerol Stock
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203452.1-539s1c1
Sequence:CCGGCGAGTTTCCCATTCTCCTCTACTCGAGTAGAGGAGAATGGGAAACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203452.1-419s1c1
Sequence:CCGGGCGTGCAATAACTACCAATATCTCGAGATATTGGTAGTTATTGCACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160175    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203452.1-2974s1c1
Sequence:CCGGCCACTATTCATCTACAGAAATCTCGAGATTTCTGTAGATGAATAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203452.1-412s1c1
Sequence:CCGGGATGAAAGCGTGCAATAACTACTCGAGTAGTTATTGCACGCTTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164321    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203452.1-2061s1c1
Sequence:CCGGCGTCTCATATAGATGTCCCATCTCGAGATGGGACATCTATATGAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203452.1-2842s1c1
Sequence:CCGGCCCAGTTATTCTTCCAGCAAACTCGAGTTTGCTGGAAGAATAACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203452.1-409s1c1
Sequence:CCGGCAAGATGAAAGCGTGCAATAACTCGAGTTATTGCACGCTTTCATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203452
MGC39545 MISSION shRNA shRNA Plasmid DNA
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203452.1-539s1c1
Sequence:CCGGCGAGTTTCCCATTCTCCTCTACTCGAGTAGAGGAGAATGGGAAACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203452.1-419s1c1
Sequence:CCGGGCGTGCAATAACTACCAATATCTCGAGATATTGGTAGTTATTGCACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160175    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203452.1-2974s1c1
Sequence:CCGGCCACTATTCATCTACAGAAATCTCGAGATTTCTGTAGATGAATAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203452.1-412s1c1
Sequence:CCGGGATGAAAGCGTGCAATAACTACTCGAGTAGTTATTGCACGCTTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164321    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203452.1-2061s1c1
Sequence:CCGGCGTCTCATATAGATGTCCCATCTCGAGATGGGACATCTATATGAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203452.1-2842s1c1
Sequence:CCGGCCCAGTTATTCTTCCAGCAAACTCGAGTTTGCTGGAAGAATAACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203452.1-409s1c1
Sequence:CCGGCAAGATGAAAGCGTGCAATAACTCGAGTTATTGCACGCTTTCATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203452
MGC39545 MISSION shRNA Lentiviral Transduction Particles
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203452.1-539s1c1
Sequence:CCGGCGAGTTTCCCATTCTCCTCTACTCGAGTAGAGGAGAATGGGAAACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203452.1-419s1c1
Sequence:CCGGGCGTGCAATAACTACCAATATCTCGAGATATTGGTAGTTATTGCACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160175    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203452.1-2974s1c1
Sequence:CCGGCCACTATTCATCTACAGAAATCTCGAGATTTCTGTAGATGAATAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203452.1-412s1c1
Sequence:CCGGGATGAAAGCGTGCAATAACTACTCGAGTAGTTATTGCACGCTTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164321    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203452.1-2061s1c1
Sequence:CCGGCGTCTCATATAGATGTCCCATCTCGAGATGGGACATCTATATGAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203452.1-2842s1c1
Sequence:CCGGCCCAGTTATTCTTCCAGCAAACTCGAGTTTGCTGGAAGAATAACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203452.1-409s1c1
Sequence:CCGGCAAGATGAAAGCGTGCAATAACTCGAGTTATTGCACGCTTTCATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)