EMAIL THIS PAGE TO A FRIEND

MGC40069

10 Gene Product Result for
Species: Human MGC40069(348035)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182615 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182615 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182615 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182615 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127498 predicted 246
2 SASI_Hs01_00127499 predicted 236
3 SASI_Hs01_00127500 predicted 239
4 SASI_Hs01_00127501 predicted 270
5 SASI_Hs01_00127502 predicted 234
6 SASI_Hs01_00127503 predicted 268
7 SASI_Hs01_00127504 predicted 294
8 SASI_Hs01_00127505 predicted 212
9 SASI_Hs01_00127506 predicted 210
10 SASI_Hs01_00127507 predicted 269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182615
MGC40069 MISSION shRNA Bacterial Glycerol Stock
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-372s1c1
Sequence:CCGGGAAGGAGGATGAATCTTTCCACTCGAGTGGAAAGATTCATCCTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182615.1-1119s1c1
Sequence:CCGGCCAGATTTATACATGCACCAACTCGAGTTGGTGCATGTATAAATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-275s1c1
Sequence:CCGGCTTATCTCTTCTGGATGGAAACTCGAGTTTCCATCCAGAAGAGATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-288s1c1
Sequence:CCGGGATGGAAAGAACTGTTGAAGACTCGAGTCTTCAACAGTTCTTTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-409s1c1
Sequence:CCGGCGCTATAATGTATTAGAGGCACTCGAGTGCCTCTAATACATTATAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-346s1c1
Sequence:CCGGGTAGCAAGTAGTCTGGAGAAACTCGAGTTTCTCCAGACTACTTGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-379s1c1
Sequence:CCGGGATGAATCTTTCCAGCTGCTACTCGAGTAGCAGCTGGAAAGATTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-442s1c1
Sequence:CCGGCCTTTGATAAGATGGCTAACTCTCGAGAGTTAGCCATCTTATCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-439s1c1
Sequence:CCGGCTACCTTTGATAAGATGGCTACTCGAGTAGCCATCTTATCAAAGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-461s1c1
Sequence:CCGGCTTCAGGTGACTCACTGTTATCTCGAGATAACAGTGAGTCACCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182615
MGC40069 MISSION shRNA shRNA Plasmid DNA
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-372s1c1
Sequence:CCGGGAAGGAGGATGAATCTTTCCACTCGAGTGGAAAGATTCATCCTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182615.1-1119s1c1
Sequence:CCGGCCAGATTTATACATGCACCAACTCGAGTTGGTGCATGTATAAATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-275s1c1
Sequence:CCGGCTTATCTCTTCTGGATGGAAACTCGAGTTTCCATCCAGAAGAGATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-288s1c1
Sequence:CCGGGATGGAAAGAACTGTTGAAGACTCGAGTCTTCAACAGTTCTTTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-409s1c1
Sequence:CCGGCGCTATAATGTATTAGAGGCACTCGAGTGCCTCTAATACATTATAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-346s1c1
Sequence:CCGGGTAGCAAGTAGTCTGGAGAAACTCGAGTTTCTCCAGACTACTTGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-379s1c1
Sequence:CCGGGATGAATCTTTCCAGCTGCTACTCGAGTAGCAGCTGGAAAGATTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-442s1c1
Sequence:CCGGCCTTTGATAAGATGGCTAACTCTCGAGAGTTAGCCATCTTATCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-439s1c1
Sequence:CCGGCTACCTTTGATAAGATGGCTACTCGAGTAGCCATCTTATCAAAGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-461s1c1
Sequence:CCGGCTTCAGGTGACTCACTGTTATCTCGAGATAACAGTGAGTCACCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182615
MGC40069 MISSION shRNA Lentiviral Transduction Particles
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-372s1c1
Sequence:CCGGGAAGGAGGATGAATCTTTCCACTCGAGTGGAAAGATTCATCCTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182615.1-1119s1c1
Sequence:CCGGCCAGATTTATACATGCACCAACTCGAGTTGGTGCATGTATAAATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-275s1c1
Sequence:CCGGCTTATCTCTTCTGGATGGAAACTCGAGTTTCCATCCAGAAGAGATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-288s1c1
Sequence:CCGGGATGGAAAGAACTGTTGAAGACTCGAGTCTTCAACAGTTCTTTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-409s1c1
Sequence:CCGGCGCTATAATGTATTAGAGGCACTCGAGTGCCTCTAATACATTATAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-346s1c1
Sequence:CCGGGTAGCAAGTAGTCTGGAGAAACTCGAGTTTCTCCAGACTACTTGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-379s1c1
Sequence:CCGGGATGAATCTTTCCAGCTGCTACTCGAGTAGCAGCTGGAAAGATTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-442s1c1
Sequence:CCGGCCTTTGATAAGATGGCTAACTCTCGAGAGTTAGCCATCTTATCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-439s1c1
Sequence:CCGGCTACCTTTGATAAGATGGCTACTCGAGTAGCCATCTTATCAAAGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182615.1-461s1c1
Sequence:CCGGCTTCAGGTGACTCACTGTTATCTCGAGATAACAGTGAGTCACCTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)