EMAIL THIS PAGE TO A FRIEND

MGC45800

32 Gene Product Result for
Species: Human MGC45800(90768)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178838 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178838 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178838 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_017780 Rosetta Predictions human pricing
XR_039902 Rosetta Predictions human pricing
XR_039903 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494452 predicted 1304
2 SASI_Hs02_00494453 predicted 1319
3 SASI_Hs02_00494454 predicted 1215
4 SASI_Hs02_00494455 predicted 420
5 SASI_Hs02_00494456 predicted 1324
6 SASI_Hs02_00494457 predicted 1395
7 SASI_Hs02_00494458 predicted 1346
8 SASI_Hs02_00494459 predicted 1888
9 SASI_Hs02_00494460 predicted 426
10 SASI_Hs02_00494461 predicted 1200
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514083 predicted 939
2 SASI_Hs02_00514084 predicted 951
3 SASI_Hs02_00514085 predicted 841
4 SASI_Hs02_00514086 predicted 963
5 SASI_Hs02_00514087 predicted 1028
6 SASI_Hs02_00514088 predicted 1530
7 SASI_Hs02_00514089 predicted 975
8 SASI_Hs02_00514090 predicted 928
9 SASI_Hs02_00514091 predicted 1527
10 SASI_Hs02_00514092 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514093 predicted 1308
2 SASI_Hs02_00514094 predicted 1314
3 SASI_Hs02_00514095 predicted 1212
4 SASI_Hs02_00514096 predicted 426
5 SASI_Hs02_00514097 predicted 1325
6 SASI_Hs02_00514098 predicted 1389
7 SASI_Hs02_00514099 predicted 1346
8 SASI_Hs02_00514100 predicted 1890
9 SASI_Hs02_00514101 predicted 425
10 SASI_Hs02_00514102 predicted 1199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178838
MGC45800 MISSION shRNA Bacterial Glycerol Stock
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178838.3-1348s1c1
Sequence:CCGGCCGTTAGGAAATCCACTTGCACTCGAGTGCAAGTGGATTTCCTAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178838.3-1380s1c1
Sequence:CCGGCGTGCAGAACCAGAAACAGATCTCGAGATCTGTTTCTGGTTCTGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178838.3-1350s1c1
Sequence:CCGGGTTAGGAAATCCACTTGCATTCTCGAGAATGCAAGTGGATTTCCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162289    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178838.3-1693s1c1
Sequence:CCGGCCACTGAATTTCACACTTGAACTCGAGTTCAAGTGTGAAATTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178838.3-1349s1c1
Sequence:CCGGCGTTAGGAAATCCACTTGCATCTCGAGATGCAAGTGGATTTCCTAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164318    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178838.3-1562s1c1
Sequence:CCGGCGCGTTAAGTAGAGAAGTCTTCTCGAGAAGACTTCTCTACTTAACGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178838.3-2028s1c1
Sequence:CCGGCCAGAACTGAAGTGCTACATTCTCGAGAATGTAGCACTTCAGTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178838.3-1383s1c1
Sequence:CCGGGCAGAACCAGAAACAGATCGACTCGAGTCGATCTGTTTCTGGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178838.3-1386s1c1
Sequence:CCGGGAACCAGAAACAGATCGAGCACTCGAGTGCTCGATCTGTTTCTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165414    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178838.3-1636s1c1
Sequence:CCGGCGCATATCTTTGCGGGAAGAACTCGAGTTCTTCCCGCAAAGATATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165710    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178838.3-1857s1c1
Sequence:CCGGCCGGACATGATCGTAAGGAAACTCGAGTTTCCTTACGATCATGTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178838
MGC45800 MISSION shRNA shRNA Plasmid DNA
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178838.3-1348s1c1
Sequence:CCGGCCGTTAGGAAATCCACTTGCACTCGAGTGCAAGTGGATTTCCTAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178838.3-1380s1c1
Sequence:CCGGCGTGCAGAACCAGAAACAGATCTCGAGATCTGTTTCTGGTTCTGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178838.3-1350s1c1
Sequence:CCGGGTTAGGAAATCCACTTGCATTCTCGAGAATGCAAGTGGATTTCCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162289    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178838.3-1693s1c1
Sequence:CCGGCCACTGAATTTCACACTTGAACTCGAGTTCAAGTGTGAAATTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178838.3-1349s1c1
Sequence:CCGGCGTTAGGAAATCCACTTGCATCTCGAGATGCAAGTGGATTTCCTAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164318    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178838.3-1562s1c1
Sequence:CCGGCGCGTTAAGTAGAGAAGTCTTCTCGAGAAGACTTCTCTACTTAACGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178838.3-2028s1c1
Sequence:CCGGCCAGAACTGAAGTGCTACATTCTCGAGAATGTAGCACTTCAGTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178838.3-1383s1c1
Sequence:CCGGGCAGAACCAGAAACAGATCGACTCGAGTCGATCTGTTTCTGGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178838.3-1386s1c1
Sequence:CCGGGAACCAGAAACAGATCGAGCACTCGAGTGCTCGATCTGTTTCTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165414    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178838.3-1636s1c1
Sequence:CCGGCGCATATCTTTGCGGGAAGAACTCGAGTTCTTCCCGCAAAGATATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165710    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178838.3-1857s1c1
Sequence:CCGGCCGGACATGATCGTAAGGAAACTCGAGTTTCCTTACGATCATGTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178838
MGC45800 MISSION shRNA Lentiviral Transduction Particles
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178838.3-1348s1c1
Sequence:CCGGCCGTTAGGAAATCCACTTGCACTCGAGTGCAAGTGGATTTCCTAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178838.3-1380s1c1
Sequence:CCGGCGTGCAGAACCAGAAACAGATCTCGAGATCTGTTTCTGGTTCTGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178838.3-1350s1c1
Sequence:CCGGGTTAGGAAATCCACTTGCATTCTCGAGAATGCAAGTGGATTTCCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162289    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178838.3-1693s1c1
Sequence:CCGGCCACTGAATTTCACACTTGAACTCGAGTTCAAGTGTGAAATTCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178838.3-1349s1c1
Sequence:CCGGCGTTAGGAAATCCACTTGCATCTCGAGATGCAAGTGGATTTCCTAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164318    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178838.3-1562s1c1
Sequence:CCGGCGCGTTAAGTAGAGAAGTCTTCTCGAGAAGACTTCTCTACTTAACGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178838.3-2028s1c1
Sequence:CCGGCCAGAACTGAAGTGCTACATTCTCGAGAATGTAGCACTTCAGTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178838.3-1383s1c1
Sequence:CCGGGCAGAACCAGAAACAGATCGACTCGAGTCGATCTGTTTCTGGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178838.3-1386s1c1
Sequence:CCGGGAACCAGAAACAGATCGAGCACTCGAGTGCTCGATCTGTTTCTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165414    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178838.3-1636s1c1
Sequence:CCGGCGCATATCTTTGCGGGAAGAACTCGAGTTCTTCCCGCAAAGATATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165710    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178838.3-1857s1c1
Sequence:CCGGCCGGACATGATCGTAAGGAAACTCGAGTTTCCTTACGATCATGTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)