EMAIL THIS PAGE TO A FRIEND

MGC50722

13 Gene Product Result for
Species: Human MGC50722(399693)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2103875 Anti-MGC50722, (N-terminal) antibody produced in rabbit affinity isolated antibody horse, human, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203348 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203348 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203348 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203348 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089309 predicted 2488
2 SASI_Hs01_00089310 predicted 1534
3 SASI_Hs01_00089311 predicted 3026
4 SASI_Hs01_00089312 predicted 2710
5 SASI_Hs01_00089313 predicted 1198
6 SASI_Hs01_00089314 predicted 1066
7 SASI_Hs01_00089315 predicted 2745
8 SASI_Hs01_00089316 predicted 2154
9 SASI_Hs01_00089317 predicted 2143
10 SASI_Hs01_00089318 predicted 2062
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203348
MGC50722 MISSION shRNA Bacterial Glycerol Stock
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1526s1c1
Sequence:CCGGCCATGACAGAGAGGAAGCATTCTCGAGAATGCTTCCTCTCTGTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1201s1c1
Sequence:CCGGGACTTAGGAGACAGCGAGAAACTCGAGTTTCTCGCTGTCTCCTAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1532s1c1
Sequence:CCGGCAGAGAGGAAGCATTCCTCTTCTCGAGAAGAGGAATGCTTCCTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-2472s1c1
Sequence:CCGGGTGTTTGAACAGAGCCTGGAACTCGAGTTCCAGGCTCTGTTCAAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1045s1c1
Sequence:CCGGGCGGCCAAAGACAAACACAAACTCGAGTTTGTGTTTGTCTTTGGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1054s1c1
Sequence:CCGGGACAAACACAAAGACGAAGATCTCGAGATCTTCGTCTTTGTGTTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1534s1c1
Sequence:CCGGGAGAGGAAGCATTCCTCTTTACTCGAGTAAAGAGGAATGCTTCCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1215s1c1
Sequence:CCGGCGAGAAAGTCATAGCTGCCAACTCGAGTTGGCAGCTATGACTTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1498s1c1
Sequence:CCGGCAGAGCTCCTTCTCTAAGAGTCTCGAGACTCTTAGAGAAGGAGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203348
MGC50722 MISSION shRNA shRNA Plasmid DNA
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1526s1c1
Sequence:CCGGCCATGACAGAGAGGAAGCATTCTCGAGAATGCTTCCTCTCTGTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1201s1c1
Sequence:CCGGGACTTAGGAGACAGCGAGAAACTCGAGTTTCTCGCTGTCTCCTAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1532s1c1
Sequence:CCGGCAGAGAGGAAGCATTCCTCTTCTCGAGAAGAGGAATGCTTCCTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-2472s1c1
Sequence:CCGGGTGTTTGAACAGAGCCTGGAACTCGAGTTCCAGGCTCTGTTCAAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1045s1c1
Sequence:CCGGGCGGCCAAAGACAAACACAAACTCGAGTTTGTGTTTGTCTTTGGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1054s1c1
Sequence:CCGGGACAAACACAAAGACGAAGATCTCGAGATCTTCGTCTTTGTGTTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1534s1c1
Sequence:CCGGGAGAGGAAGCATTCCTCTTTACTCGAGTAAAGAGGAATGCTTCCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1215s1c1
Sequence:CCGGCGAGAAAGTCATAGCTGCCAACTCGAGTTGGCAGCTATGACTTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1498s1c1
Sequence:CCGGCAGAGCTCCTTCTCTAAGAGTCTCGAGACTCTTAGAGAAGGAGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203348
MGC50722 MISSION shRNA Lentiviral Transduction Particles
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1526s1c1
Sequence:CCGGCCATGACAGAGAGGAAGCATTCTCGAGAATGCTTCCTCTCTGTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1201s1c1
Sequence:CCGGGACTTAGGAGACAGCGAGAAACTCGAGTTTCTCGCTGTCTCCTAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1532s1c1
Sequence:CCGGCAGAGAGGAAGCATTCCTCTTCTCGAGAAGAGGAATGCTTCCTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-2472s1c1
Sequence:CCGGGTGTTTGAACAGAGCCTGGAACTCGAGTTCCAGGCTCTGTTCAAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1045s1c1
Sequence:CCGGGCGGCCAAAGACAAACACAAACTCGAGTTTGTGTTTGTCTTTGGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1054s1c1
Sequence:CCGGGACAAACACAAAGACGAAGATCTCGAGATCTTCGTCTTTGTGTTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1534s1c1
Sequence:CCGGGAGAGGAAGCATTCCTCTTTACTCGAGTAAAGAGGAATGCTTCCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1215s1c1
Sequence:CCGGCGAGAAAGTCATAGCTGCCAACTCGAGTTGGCAGCTATGACTTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203348.1-1498s1c1
Sequence:CCGGCAGAGCTCCTTCTCTAAGAGTCTCGAGACTCTTAGAGAAGGAGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)