EMAIL THIS PAGE TO A FRIEND

MGC70870

22 Gene Product Result for
Species: Human MGC70870(403340)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203481 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203481 Rosetta Predictions human pricing
NR_003682 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043042 predicted 704
2 SASI_Hs01_00043043 predicted 941
3 SASI_Hs01_00043044 predicted 1291
4 SASI_Hs01_00043045 predicted 938
5 SASI_Hs01_00043046 predicted 819
6 SASI_Hs01_00043047 predicted 905
7 SASI_Hs01_00043048 predicted 1225
8 SASI_Hs01_00043049 predicted 1298
9 SASI_Hs01_00043050 predicted 455
10 SASI_Hs01_00043051 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00380139 predicted 426
2 SASI_Hs02_00380140 predicted 1762
3 SASI_Hs02_00380141 predicted 1270
4 SASI_Hs02_00380142 predicted 598
5 SASI_Hs02_00380143 predicted 1865
6 SASI_Hs02_00380144 predicted 1063
7 SASI_Hs02_00380145 predicted 1627
8 SASI_Hs02_00380146 predicted 326
9 SASI_Hs02_00380147 predicted 1712
10 SASI_Hs02_00380148 predicted 1626
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203481
MGC70870 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203481.1-454s1c1
Sequence:CCGGCGCCATGATGTACCACAACTTCTCGAGAAGTTGTGGTACATCATGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203481.1-697s1c1
Sequence:CCGGCACACGAGTTCACAGCGTGGACTCGAGTCCACGCTGTGAACTCGTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203481.1-462s1c1
Sequence:CCGGTGTACCACAACTTCTCCCTCACTCGAGTGAGGGAGAAGTTGTGGTACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203481.1-791s1c1
Sequence:CCGGACGCAGCAGGAGGTTGCAGTTCTCGAGAACTGCAACCTCCTGCTGCGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203481.1-577s1c1
Sequence:CCGGCGAAATTGCTCTGTGCAGCATCTCGAGATGCTGCACAGAGCAATTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203481
MGC70870 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203481.1-454s1c1
Sequence:CCGGCGCCATGATGTACCACAACTTCTCGAGAAGTTGTGGTACATCATGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203481.1-697s1c1
Sequence:CCGGCACACGAGTTCACAGCGTGGACTCGAGTCCACGCTGTGAACTCGTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203481.1-462s1c1
Sequence:CCGGTGTACCACAACTTCTCCCTCACTCGAGTGAGGGAGAAGTTGTGGTACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203481.1-791s1c1
Sequence:CCGGACGCAGCAGGAGGTTGCAGTTCTCGAGAACTGCAACCTCCTGCTGCGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203481.1-577s1c1
Sequence:CCGGCGAAATTGCTCTGTGCAGCATCTCGAGATGCTGCACAGAGCAATTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203481
MGC70870 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203481.1-454s1c1
Sequence:CCGGCGCCATGATGTACCACAACTTCTCGAGAAGTTGTGGTACATCATGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203481.1-697s1c1
Sequence:CCGGCACACGAGTTCACAGCGTGGACTCGAGTCCACGCTGTGAACTCGTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203481.1-462s1c1
Sequence:CCGGTGTACCACAACTTCTCCCTCACTCGAGTGAGGGAGAAGTTGTGGTACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203481.1-791s1c1
Sequence:CCGGACGCAGCAGGAGGTTGCAGTTCTCGAGAACTGCAACCTCCTGCTGCGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203481.1-577s1c1
Sequence:CCGGCGAAATTGCTCTGTGCAGCATCTCGAGATGCTGCACAGAGCAATTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)