EMAIL THIS PAGE TO A FRIEND

MGEA5

meningioma expressed antigen 5 (hyaluronidase)

187 Gene Product Result for
Synonyms: MEA5 NCOAT OGA
Gene ID:
Human(10724) Summary: The dynamic modification of cytoplasmic and nuclear proteins by O-linked N-acetylglucosamine (O-GlcNAc) addition and removal on serine and threonine residues is catalyzed by OGT (MIM 300255), which adds O-GlcNAc, and MGEA5, a glycosidase that removes O-GlcNAc modifications (Gao et al., 2001 [PubMed 11148210]
Mouse(76055) meningioma expressed antigen 5 (hyaluronidase)
Rat(154968) meningioma expressed antigen 5 (hyaluronidase)
Zebrafish(324487) meningioma expressed antigen 5 (hyaluronidase)
chicken(423851) meningioma expressed antigen 5 (hyaluronidase)
dog(477802) meningioma expressed antigen 5 (hyaluronidase)
Horse(100060245) meningioma expressed antigen 5 (hyaluronidase)
cow(538561) meningioma expressed antigen 5 (hyaluronidase)
domestic cat(101098493) meningioma expressed antigen 5 (hyaluronidase)
sheep(101113978) meningioma expressed antigen 5 (hyaluronidase)
domestic guinea pig(100721083) meningioma expressed antigen 5 (hyaluronidase)
naked mole-rat(101702515) meningioma expressed antigen 5 (hyaluronidase)
Domestic Rabbit(100351779) meningioma expressed antigen 5 (hyaluronidase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012215 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012215 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012215 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023799 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023799 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023799 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012215 Rosetta Predictions human pricing
NM_131904 Rosetta Predictions rat pricing
NM_023799 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343882 predicted 3021
2 SASI_Hs01_00075355 predicted 2066
3 SASI_Hs02_00343883 predicted 1733
4 SASI_Hs01_00075356 predicted 802
5 SASI_Hs02_00343884 predicted 3194
6 SASI_Hs02_00343885 predicted 2887
7 SASI_Hs01_00075359 predicted 2248
8 SASI_Hs02_00343886 predicted 2415
9 SASI_Hs01_00075360 predicted 2366
10 SASI_Hs01_00075361 predicted 3236
11 SASI_Hs01_00075354 predicted 1528
12 SASI_Hs01_00075357 predicted 2593
13 SASI_Hs01_00075358 predicted 1938
14 SASI_Hs01_00075362 predicted 2240
15 SASI_Hs01_00075363 predicted 2335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_131904 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111981 predicted 1607
2 SASI_Rn01_00111982 predicted 778
3 SASI_Rn01_00111983 predicted 1052
4 SASI_Rn01_00111984 predicted 2147
5 SASI_Rn02_00267530 predicted 831
6 SASI_Rn01_00111985 predicted 2246
7 SASI_Rn01_00111986 predicted 1922
8 SASI_Rn01_00111987 predicted 1659
9 SASI_Rn02_00267531 predicted 2321
10 SASI_Rn01_00111988 predicted 1973
11 SASI_Rn01_00111989 predicted 1931
12 SASI_Rn01_00111990 predicted 1676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023799 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099393 predicted 1075
2 SASI_Mm01_00099394 predicted 509
3 SASI_Mm01_00099395 predicted 2306
4 SASI_Mm01_00099396 predicted 2405
5 SASI_Mm01_00099397 predicted 3008
6 SASI_Mm01_00099398 predicted 1768
7 SASI_Mm01_00099399 predicted 2444
8 SASI_Mm01_00099400 predicted 2093
9 SASI_Mm02_00327366 predicted 1404
10 SASI_Mm01_00099402 predicted 2077
11 SASI_Mm01_00099401 predicted 2237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012215
VALIDATED
MGEA5 MISSION shRNA Bacterial Glycerol Stock
meningioma expressed antigen 5 (hyaluronidase)
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012215.1-4183s1c1
Sequence:CCGGCCCTCAGGTCAGTTGTTTAATCTCGAGATTAAACAACTGACCTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012215.1-3111s1c1
Sequence:CCGGCCAAAGGATGTGGTTATACTTCTCGAGAAGTATAACCACATCCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012215.1-2622s1c1
Sequence:CCGGCCCTTTCAAAGTCAGCCTGATCTCGAGATCAGGCTGACTTTGAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012215.1-785s1c1
Sequence:CCGGGATAGAGTTCATCTATGCGATCTCGAGATCGCATAGATGAACTCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012215.1-2889s1c1
Sequence:CCGGCCAGAAACTTTCCTTGCTAATCTCGAGATTAGCAAGGAAAGTTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012215.1-1218s1c1
Sequence:CCGGCCAGTAATCTGGGATAACATTCTCGAGAATGTTATCCCAGATTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012215.1-2386s1c1
Sequence:CCGGGTAGTCATTCTTCAGCACAATCTCGAGATTGTGCTGAAGAATGACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012215.1-1043s1c1
Sequence:CCGGCACAGAATACTGTGGCACTTTCTCGAGAAAGTGCCACAGTATTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012215.1-2802s1c1
Sequence:CCGGGAGAAGTATACCAAGCCAAATCTCGAGATTTGGCTTGGTATACTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012215.3-3673s21c1
Sequence:CCGGGATGGTTGTGGCATTAGTTTACTCGAGTAAACTAATGCCACAACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012215.3-1125s21c1
Sequence:CCGGGTGTCTCAGTCTCCATATTTACTCGAGTAAATATGGAGACTGAGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135877    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012215.1-4731s1c1
Sequence:CCGGGCTGGAACCAAGTTTGCATTTCTCGAGAAATGCAAACTTGGTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133855    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012215.1-4649s1c1
Sequence:CCGGGCACTAAATAGGTGAGAAGAACTCGAGTTCTTCTCACCTATTTAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012215.3-896s21c1
Sequence:CCGGATCCACATTGAAACGTAAATTCTCGAGAATTTACGTTTCAATGTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012215.3-3159s21c1
Sequence:CCGGCCAAAGGATGTGGTTATACTTCTCGAGAAGTATAACCACATCCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012215.3-2937s21c1
Sequence:CCGGCCAGAAACTTTCCTTGCTAATCTCGAGATTAGCAAGGAAAGTTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012215
VALIDATED
MGEA5 MISSION shRNA shRNA Plasmid DNA
meningioma expressed antigen 5 (hyaluronidase)
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012215.1-4183s1c1
Sequence:CCGGCCCTCAGGTCAGTTGTTTAATCTCGAGATTAAACAACTGACCTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012215.1-3111s1c1
Sequence:CCGGCCAAAGGATGTGGTTATACTTCTCGAGAAGTATAACCACATCCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012215.1-2622s1c1
Sequence:CCGGCCCTTTCAAAGTCAGCCTGATCTCGAGATCAGGCTGACTTTGAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012215.1-785s1c1
Sequence:CCGGGATAGAGTTCATCTATGCGATCTCGAGATCGCATAGATGAACTCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012215.1-2889s1c1
Sequence:CCGGCCAGAAACTTTCCTTGCTAATCTCGAGATTAGCAAGGAAAGTTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012215.1-1218s1c1
Sequence:CCGGCCAGTAATCTGGGATAACATTCTCGAGAATGTTATCCCAGATTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012215.1-2386s1c1
Sequence:CCGGGTAGTCATTCTTCAGCACAATCTCGAGATTGTGCTGAAGAATGACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012215.1-1043s1c1
Sequence:CCGGCACAGAATACTGTGGCACTTTCTCGAGAAAGTGCCACAGTATTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012215.1-2802s1c1
Sequence:CCGGGAGAAGTATACCAAGCCAAATCTCGAGATTTGGCTTGGTATACTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012215.3-3673s21c1
Sequence:CCGGGATGGTTGTGGCATTAGTTTACTCGAGTAAACTAATGCCACAACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012215.3-1125s21c1
Sequence:CCGGGTGTCTCAGTCTCCATATTTACTCGAGTAAATATGGAGACTGAGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135877    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012215.1-4731s1c1
Sequence:CCGGGCTGGAACCAAGTTTGCATTTCTCGAGAAATGCAAACTTGGTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133855    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012215.1-4649s1c1
Sequence:CCGGGCACTAAATAGGTGAGAAGAACTCGAGTTCTTCTCACCTATTTAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012215.3-896s21c1
Sequence:CCGGATCCACATTGAAACGTAAATTCTCGAGAATTTACGTTTCAATGTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012215.3-3159s21c1
Sequence:CCGGCCAAAGGATGTGGTTATACTTCTCGAGAAGTATAACCACATCCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012215.3-2937s21c1
Sequence:CCGGCCAGAAACTTTCCTTGCTAATCTCGAGATTAGCAAGGAAAGTTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012215
VALIDATED
MGEA5 MISSION shRNA Lentiviral Transduction Particles
meningioma expressed antigen 5 (hyaluronidase)
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012215.1-4183s1c1
Sequence:CCGGCCCTCAGGTCAGTTGTTTAATCTCGAGATTAAACAACTGACCTGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012215.1-3111s1c1
Sequence:CCGGCCAAAGGATGTGGTTATACTTCTCGAGAAGTATAACCACATCCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012215.1-2622s1c1
Sequence:CCGGCCCTTTCAAAGTCAGCCTGATCTCGAGATCAGGCTGACTTTGAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012215.1-785s1c1
Sequence:CCGGGATAGAGTTCATCTATGCGATCTCGAGATCGCATAGATGAACTCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012215.1-2889s1c1
Sequence:CCGGCCAGAAACTTTCCTTGCTAATCTCGAGATTAGCAAGGAAAGTTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012215.1-1218s1c1
Sequence:CCGGCCAGTAATCTGGGATAACATTCTCGAGAATGTTATCCCAGATTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012215.1-2386s1c1
Sequence:CCGGGTAGTCATTCTTCAGCACAATCTCGAGATTGTGCTGAAGAATGACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012215.1-1043s1c1
Sequence:CCGGCACAGAATACTGTGGCACTTTCTCGAGAAAGTGCCACAGTATTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012215.1-2802s1c1
Sequence:CCGGGAGAAGTATACCAAGCCAAATCTCGAGATTTGGCTTGGTATACTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012215.3-3673s21c1
Sequence:CCGGGATGGTTGTGGCATTAGTTTACTCGAGTAAACTAATGCCACAACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012215.3-1125s21c1
Sequence:CCGGGTGTCTCAGTCTCCATATTTACTCGAGTAAATATGGAGACTGAGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135877    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012215.1-4731s1c1
Sequence:CCGGGCTGGAACCAAGTTTGCATTTCTCGAGAAATGCAAACTTGGTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133855    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012215.1-4649s1c1
Sequence:CCGGGCACTAAATAGGTGAGAAGAACTCGAGTTCTTCTCACCTATTTAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012215.3-896s21c1
Sequence:CCGGATCCACATTGAAACGTAAATTCTCGAGAATTTACGTTTCAATGTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012215.3-3159s21c1
Sequence:CCGGCCAAAGGATGTGGTTATACTTCTCGAGAAGTATAACCACATCCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012215.3-2937s21c1
Sequence:CCGGCCAGAAACTTTCCTTGCTAATCTCGAGATTAGCAAGGAAAGTTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023799
VALIDATED
MGEA5 MISSION shRNA Bacterial Glycerol Stock
meningioma expressed antigen 5 (hyaluronidase)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023799.2-3257s1c1
Sequence:CCGGGCAACGAAGTTCACTCTCTTTCTCGAGAAAGAGAGTGAACTTCGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248911    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023799.3-4071s21c1
Sequence:CCGGATAGTGTCTGCAGGATTATTACTCGAGTAATAATCCTGCAGACACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023799.3-1065s21c1
Sequence:CCGGGAGCTCATCCCACGGTTAAAGCTCGAGCTTTAACCGTGGGATGAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023799.2-2293s1c1
Sequence:CCGGCCTCCAAAGTTTATACTATCACTCGAGTGATAGTATAAACTTTGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023799.3-2304s21c1
Sequence:CCGGTATACTATCAGACCTTATTTCCTCGAGGAAATAAGGTCTGATAGTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023799.3-527s21c1
Sequence:CCGGGATCTCTGCTGCACGAGAATACTCGAGTATTCTCGTGCAGCAGAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023799.3-615s21c1
Sequence:CCGGTCAACGTTGAAACGCAAATTGCTCGAGCAATTTGCGTTTCAACGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023799.3-822s1c1
Sequence:CCGGGGCACTTTCTGTTATCCAAATCTCGAGATTTGGATAACAGAAAGTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023799.3-1087s1c1
Sequence:CCGGGAGTACTAACCAATCCAAATTCTCGAGAATTTGGATTGGTTAGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023799
VALIDATED
MGEA5 MISSION shRNA shRNA Plasmid DNA
meningioma expressed antigen 5 (hyaluronidase)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023799.2-3257s1c1
Sequence:CCGGGCAACGAAGTTCACTCTCTTTCTCGAGAAAGAGAGTGAACTTCGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248911    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023799.3-4071s21c1
Sequence:CCGGATAGTGTCTGCAGGATTATTACTCGAGTAATAATCCTGCAGACACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023799.3-1065s21c1
Sequence:CCGGGAGCTCATCCCACGGTTAAAGCTCGAGCTTTAACCGTGGGATGAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023799.2-2293s1c1
Sequence:CCGGCCTCCAAAGTTTATACTATCACTCGAGTGATAGTATAAACTTTGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023799.3-2304s21c1
Sequence:CCGGTATACTATCAGACCTTATTTCCTCGAGGAAATAAGGTCTGATAGTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023799.3-527s21c1
Sequence:CCGGGATCTCTGCTGCACGAGAATACTCGAGTATTCTCGTGCAGCAGAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023799.3-615s21c1
Sequence:CCGGTCAACGTTGAAACGCAAATTGCTCGAGCAATTTGCGTTTCAACGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023799.3-822s1c1
Sequence:CCGGGGCACTTTCTGTTATCCAAATCTCGAGATTTGGATAACAGAAAGTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023799.3-1087s1c1
Sequence:CCGGGAGTACTAACCAATCCAAATTCTCGAGAATTTGGATTGGTTAGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023799
VALIDATED
MGEA5 MISSION shRNA Lentiviral Transduction Particles
meningioma expressed antigen 5 (hyaluronidase)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023799.2-3257s1c1
Sequence:CCGGGCAACGAAGTTCACTCTCTTTCTCGAGAAAGAGAGTGAACTTCGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248911    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023799.3-4071s21c1
Sequence:CCGGATAGTGTCTGCAGGATTATTACTCGAGTAATAATCCTGCAGACACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023799.3-1065s21c1
Sequence:CCGGGAGCTCATCCCACGGTTAAAGCTCGAGCTTTAACCGTGGGATGAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023799.2-2293s1c1
Sequence:CCGGCCTCCAAAGTTTATACTATCACTCGAGTGATAGTATAAACTTTGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023799.3-2304s21c1
Sequence:CCGGTATACTATCAGACCTTATTTCCTCGAGGAAATAAGGTCTGATAGTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023799.3-527s21c1
Sequence:CCGGGATCTCTGCTGCACGAGAATACTCGAGTATTCTCGTGCAGCAGAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023799.3-615s21c1
Sequence:CCGGTCAACGTTGAAACGCAAATTGCTCGAGCAATTTGCGTTTCAACGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023799.3-822s1c1
Sequence:CCGGGGCACTTTCTGTTATCCAAATCTCGAGATTTGGATAACAGAAAGTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023799.3-1087s1c1
Sequence:CCGGGAGTACTAACCAATCCAAATTCTCGAGAATTTGGATTGGTTAGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)