EMAIL THIS PAGE TO A FRIEND

MGLL

monoglyceride lipase

71 Gene Product Result for
Synonyms: HU-K5 HUK5 MAGL MGL
UniProtKB ID: Q99685, B3KRC2, B7Z9D1, Q6IBG9, Q96AA5
Gene ID:
Human(11343) Summary: This gene encodes a serine hydrolase of the AB hydrolase superfamily that catalyzes the conversion of monoacylglycerides to free fatty acids and glycerol. The encoded protein plays a critical role in several physiological processes including pain and nociperception through hydrolysis of the endocannabinoid 2-arachidonoylglycerol. Expression of this gene may play a role in cancer tumorigenesis and metastasis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Mouse(23945) monoglyceride lipase
Rat(29254) monoglyceride lipase
sheep(101114312) monoglyceride lipase
naked mole-rat(101707987) monoglyceride lipase
domestic guinea pig(100723216) monoglyceride lipase
Zebrafish(378960) monoglyceride lipase
dog(476511) monoglyceride lipase
cow(505290) monoglyceride lipase
domestic cat(101089928) monoglyceride lipase
chicken(416024) monoglyceride lipase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011844 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011844 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011844 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007283 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040691 MISSION® esiRNA esiRNA human MGLL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003794 Rosetta Predictions human pricing
NM_007283 Rosetta Predictions human pricing
NM_138502 Rosetta Predictions rat pricing
NM_011844 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123409 predicted 910
2 SASI_Hs01_00123410 predicted 876
3 SASI_Hs01_00123412 predicted 619
4 SASI_Hs01_00123413 predicted 351
5 SASI_Hs01_00123416 predicted 405
6 SASI_Hs02_00304383 predicted 633
7 SASI_Hs02_00304384 predicted 548
8 SASI_Hs01_00123417 predicted 502
9 SASI_Hs01_00123418 predicted 574
10 SASI_Hs02_00304385 predicted 628
11 SASI_Hs01_00123411 predicted 561
12 SASI_Hs01_00123414 predicted 761
13 SASI_Hs01_00123415 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075919 predicted 1337
2 SASI_Hs01_00075920 predicted 1301
3 SASI_Hs01_00075922 predicted 1044
4 SASI_Hs01_00075923 predicted 776
5 SASI_Hs01_00075926 predicted 831
6 SASI_Hs02_00343347 predicted 1061
7 SASI_Hs02_00343348 predicted 979
8 SASI_Hs01_00075927 predicted 929
9 SASI_Hs01_00075928 predicted 999
10 SASI_Hs02_00343349 predicted 1056
11 SASI_Hs01_00075921 predicted 976
12 SASI_Hs01_00075924 predicted 1181
13 SASI_Hs01_00075925 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138502 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120245 predicted 599
2 SASI_Rn02_00268092 predicted 497
3 SASI_Rn01_00120246 predicted 679
4 SASI_Rn01_00120247 predicted 373
5 SASI_Rn01_00120248 predicted 727
6 SASI_Rn01_00120249 predicted 378
7 SASI_Rn01_00120251 predicted 775
8 SASI_Rn01_00120252 predicted 226
9 SASI_Rn01_00120253 predicted 819
10 SASI_Rn02_00268093 predicted 816
11 SASI_Rn01_00120250 predicted 596
12 SASI_Rn01_00120254 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011844 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106711 predicted 855
2 SASI_Mm01_00106713 predicted 482
3 SASI_Mm02_00321578 predicted 674
4 SASI_Mm01_00106714 predicted 998
5 SASI_Mm01_00106715 predicted 1080
6 SASI_Mm01_00106716 predicted 1017
7 SASI_Mm01_00106717 predicted 1075
8 SASI_Mm01_00106718 predicted 395
9 SASI_Mm01_00106719 predicted 946
10 SASI_Mm01_00106720 predicted 801
11 SASI_Mm01_00106712 predicted 543
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011844
VALIDATED
MGLL MISSION shRNA Bacterial Glycerol Stock
monoglyceride lipase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011844.3-1086s1c1
Sequence:CCGGGACCGGCTTTGCGACAGCAAACTCGAGTTTGCTGTCGCAAAGCCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011844.3-1220s1c1
Sequence:CCGGCCATGAAGTAAACTCGTGGGTCTCGAGACCCACGAGTTTACTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011844.3-498s1c1
Sequence:CCGGGCCCTCATCTTTGTGTCCCATCTCGAGATGGGACACAAAGATGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011844.3-540s1c1
Sequence:CCGGCGTTATGATGAGCTGGCTCATCTCGAGATGAGCCAGCTCATCATAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011844.3-837s1c1
Sequence:CCGGGCATCGACTTTGAAGGTCCTTCTCGAGAAGGACCTTCAAAGTCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011844
VALIDATED
MGLL MISSION shRNA shRNA Plasmid DNA
monoglyceride lipase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011844.3-1086s1c1
Sequence:CCGGGACCGGCTTTGCGACAGCAAACTCGAGTTTGCTGTCGCAAAGCCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011844.3-1220s1c1
Sequence:CCGGCCATGAAGTAAACTCGTGGGTCTCGAGACCCACGAGTTTACTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011844.3-498s1c1
Sequence:CCGGGCCCTCATCTTTGTGTCCCATCTCGAGATGGGACACAAAGATGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011844.3-540s1c1
Sequence:CCGGCGTTATGATGAGCTGGCTCATCTCGAGATGAGCCAGCTCATCATAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011844.3-837s1c1
Sequence:CCGGGCATCGACTTTGAAGGTCCTTCTCGAGAAGGACCTTCAAAGTCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011844
VALIDATED
MGLL MISSION shRNA Lentiviral Transduction Particles
monoglyceride lipase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011844.3-1086s1c1
Sequence:CCGGGACCGGCTTTGCGACAGCAAACTCGAGTTTGCTGTCGCAAAGCCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011844.3-1220s1c1
Sequence:CCGGCCATGAAGTAAACTCGTGGGTCTCGAGACCCACGAGTTTACTTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011844.3-498s1c1
Sequence:CCGGGCCCTCATCTTTGTGTCCCATCTCGAGATGGGACACAAAGATGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011844.3-540s1c1
Sequence:CCGGCGTTATGATGAGCTGGCTCATCTCGAGATGAGCCAGCTCATCATAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011844.3-837s1c1
Sequence:CCGGGCATCGACTTTGAAGGTCCTTCTCGAGAAGGACCTTCAAAGTCGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007283
VALIDATED
MGLL MISSION shRNA Bacterial Glycerol Stock
monoglyceride lipase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_007283.4-900s1c1
Sequence:CCGGGCATGTGGATTCCATGCAGAACTCGAGTTCTGCATGGAATCCACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007283.4-1046s1c1
Sequence:CCGGCCAATCCTGAATCTGCAACAACTCGAGTTGTTGCAGATTCAGGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_007283.4-1060s1c1
Sequence:CCGGGCAACAACTTTCAAGGTCCTTCTCGAGAAGGACCTTGAAAGTTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007283.4-1431s1c1
Sequence:CCGGCAACTCCGTCTTCCATGAAATCTCGAGATTTCATGGAAGACGGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007283.5-1658s21c1
Sequence:CCGGAGACACTGGACCTACCTTAATCTCGAGATTAAGGTAGGTCCAGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007283.5-1338s21c1
Sequence:CCGGCCAGGACAAGACTCTCAAGATCTCGAGATCTTGAGAGTCTTGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_007283.5-1407s21c1
Sequence:CCGGCAACTCCGTCTTCCATGAAATCTCGAGATTTCATGGAAGACGGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007283.5-1022s21c1
Sequence:CCGGCCAATCCTGAATCTGCAACAACTCGAGTTGTTGCAGATTCAGGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007283
VALIDATED
MGLL MISSION shRNA shRNA Plasmid DNA
monoglyceride lipase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_007283.4-900s1c1
Sequence:CCGGGCATGTGGATTCCATGCAGAACTCGAGTTCTGCATGGAATCCACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007283.4-1046s1c1
Sequence:CCGGCCAATCCTGAATCTGCAACAACTCGAGTTGTTGCAGATTCAGGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_007283.4-1060s1c1
Sequence:CCGGGCAACAACTTTCAAGGTCCTTCTCGAGAAGGACCTTGAAAGTTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007283.4-1431s1c1
Sequence:CCGGCAACTCCGTCTTCCATGAAATCTCGAGATTTCATGGAAGACGGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007283.5-1658s21c1
Sequence:CCGGAGACACTGGACCTACCTTAATCTCGAGATTAAGGTAGGTCCAGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007283.5-1338s21c1
Sequence:CCGGCCAGGACAAGACTCTCAAGATCTCGAGATCTTGAGAGTCTTGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_007283.5-1407s21c1
Sequence:CCGGCAACTCCGTCTTCCATGAAATCTCGAGATTTCATGGAAGACGGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007283.5-1022s21c1
Sequence:CCGGCCAATCCTGAATCTGCAACAACTCGAGTTGTTGCAGATTCAGGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007283
VALIDATED
MGLL MISSION shRNA Lentiviral Transduction Particles
monoglyceride lipase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_007283.4-900s1c1
Sequence:CCGGGCATGTGGATTCCATGCAGAACTCGAGTTCTGCATGGAATCCACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007283.4-1046s1c1
Sequence:CCGGCCAATCCTGAATCTGCAACAACTCGAGTTGTTGCAGATTCAGGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_007283.4-1060s1c1
Sequence:CCGGGCAACAACTTTCAAGGTCCTTCTCGAGAAGGACCTTGAAAGTTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007283.4-1431s1c1
Sequence:CCGGCAACTCCGTCTTCCATGAAATCTCGAGATTTCATGGAAGACGGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007283.5-1658s21c1
Sequence:CCGGAGACACTGGACCTACCTTAATCTCGAGATTAAGGTAGGTCCAGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007283.5-1338s21c1
Sequence:CCGGCCAGGACAAGACTCTCAAGATCTCGAGATCTTGAGAGTCTTGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_007283.5-1407s21c1
Sequence:CCGGCAACTCCGTCTTCCATGAAATCTCGAGATTTCATGGAAGACGGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007283.5-1022s21c1
Sequence:CCGGCCAATCCTGAATCTGCAACAACTCGAGTTGTTGCAGATTCAGGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)