EMAIL THIS PAGE TO A FRIEND

MGME1

mitochondrial genome maintenance exonuclease 1

47 Gene Product Result for
Synonyms: C20orf72 DDK1 MTDPS11 bA504H3.4
UniProtKB ID: Q9BQP7, B2RDG5, D3DW29, Q96SW3
Gene ID:
Mouse(74528) mitochondrial genome maintainance exonuclease 1
Rat(296200) mitochondrial genome maintenance exonuclease 1
Zebrafish(494097) mitochondrial genome maintenance exonuclease 1
cow(506205) mitochondrial genome maintenance exonuclease 1
naked mole-rat(101713650) mitochondrial genome maintenance exonuclease 1
domestic guinea pig(100726779) mitochondrial genome maintenance exonuclease 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028984 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028984 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028984 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052865 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052865 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052865 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054831 MISSION® esiRNA esiRNA human C20orf72 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052865 Rosetta Predictions human pricing
NM_001009655 Rosetta Predictions rat pricing
NM_028984 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052865 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104567 predicted 574
2 SASI_Hs01_00104568 predicted 1036
3 SASI_Hs01_00104569 predicted 680
4 SASI_Hs01_00104570 predicted 695
5 SASI_Hs01_00104571 predicted 393
6 SASI_Hs01_00104572 predicted 923
7 SASI_Hs01_00104573 predicted 463
8 SASI_Hs01_00104574 predicted 831
9 SASI_Hs01_00104575 predicted 750
10 SASI_Hs01_00104576 predicted 1156
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009655 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119602 predicted 740
2 SASI_Rn01_00119603 predicted 453
3 SASI_Rn01_00119604 predicted 280
4 SASI_Rn01_00119605 predicted 760
5 SASI_Rn01_00119607 predicted 219
6 SASI_Rn01_00119608 predicted 420
7 SASI_Rn01_00119609 predicted 605
8 SASI_Rn01_00119610 predicted 407
9 SASI_Rn01_00119611 predicted 275
10 SASI_Rn02_00199683 predicted 952
11 SASI_Rn01_00119606 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028984 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073952 predicted 715
2 SASI_Mm01_00073953 predicted 573
3 SASI_Mm01_00073954 predicted 256
4 SASI_Mm01_00073955 predicted 1207
5 SASI_Mm01_00073956 predicted 908
6 SASI_Mm01_00073957 predicted 325
7 SASI_Mm01_00073958 predicted 586
8 SASI_Mm01_00073959 predicted 453
9 SASI_Mm01_00073960 predicted 625
10 SASI_Mm01_00073961 predicted 392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028984
VALIDATED
MGME1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial genome maintenance exonuclease 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028984.4-133s21c1
Sequence:CCGGGCTTAGCAGGTTAAACAGATTCTCGAGAATCTGTTTAACCTGCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028984.2-1219s1c1
Sequence:CCGGGCTACATTAACACAAGCTGAACTCGAGTTCAGCTTGTGTTAATGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190591    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028984.2-1413s1c1
Sequence:CCGGGCCCAGTCTTTGAATTGAGATCTCGAGATCTCAATTCAAAGACTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028984.2-134s1c1
Sequence:CCGGGCTTAGCAGGTTAAACAGATTCTCGAGAATCTGTTTAACCTGCTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028984.2-1733s1c1
Sequence:CCGGCGCTAGGGTTTGGGTATCTATCTCGAGATAGATACCCAAACCCTAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028984.4-1412s21c1
Sequence:CCGGGCCCAGTCTTTGAATTGAGATCTCGAGATCTCAATTCAAAGACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028984.4-1732s21c1
Sequence:CCGGCGCTAGGGTTTGGGTATCTATCTCGAGATAGATACCCAAACCCTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028984.4-1218s21c1
Sequence:CCGGGCTACATTAACACAAGCTGAACTCGAGTTCAGCTTGTGTTAATGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028984
VALIDATED
MGME1 MISSION shRNA shRNA Plasmid DNA
mitochondrial genome maintenance exonuclease 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028984.4-133s21c1
Sequence:CCGGGCTTAGCAGGTTAAACAGATTCTCGAGAATCTGTTTAACCTGCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028984.2-1219s1c1
Sequence:CCGGGCTACATTAACACAAGCTGAACTCGAGTTCAGCTTGTGTTAATGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190591    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028984.2-1413s1c1
Sequence:CCGGGCCCAGTCTTTGAATTGAGATCTCGAGATCTCAATTCAAAGACTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028984.2-134s1c1
Sequence:CCGGGCTTAGCAGGTTAAACAGATTCTCGAGAATCTGTTTAACCTGCTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028984.2-1733s1c1
Sequence:CCGGCGCTAGGGTTTGGGTATCTATCTCGAGATAGATACCCAAACCCTAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028984.4-1412s21c1
Sequence:CCGGGCCCAGTCTTTGAATTGAGATCTCGAGATCTCAATTCAAAGACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028984.4-1732s21c1
Sequence:CCGGCGCTAGGGTTTGGGTATCTATCTCGAGATAGATACCCAAACCCTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028984.4-1218s21c1
Sequence:CCGGGCTACATTAACACAAGCTGAACTCGAGTTCAGCTTGTGTTAATGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028984
VALIDATED
MGME1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial genome maintenance exonuclease 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028984.4-133s21c1
Sequence:CCGGGCTTAGCAGGTTAAACAGATTCTCGAGAATCTGTTTAACCTGCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028984.2-1219s1c1
Sequence:CCGGGCTACATTAACACAAGCTGAACTCGAGTTCAGCTTGTGTTAATGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190591    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028984.2-1413s1c1
Sequence:CCGGGCCCAGTCTTTGAATTGAGATCTCGAGATCTCAATTCAAAGACTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028984.2-134s1c1
Sequence:CCGGGCTTAGCAGGTTAAACAGATTCTCGAGAATCTGTTTAACCTGCTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028984.2-1733s1c1
Sequence:CCGGCGCTAGGGTTTGGGTATCTATCTCGAGATAGATACCCAAACCCTAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028984.4-1412s21c1
Sequence:CCGGGCCCAGTCTTTGAATTGAGATCTCGAGATCTCAATTCAAAGACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028984.4-1732s21c1
Sequence:CCGGCGCTAGGGTTTGGGTATCTATCTCGAGATAGATACCCAAACCCTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028984.4-1218s21c1
Sequence:CCGGGCTACATTAACACAAGCTGAACTCGAGTTCAGCTTGTGTTAATGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052865
MGME1 MISSION shRNA Bacterial Glycerol Stock
mitochondrial genome maintenance exonuclease 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000146894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052865.2-1052s1c1
Sequence:CCGGCGACTAGAAGAATATACGGAACTCGAGTTCCGTATATTCTTCTAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052865.2-944s1c1
Sequence:CCGGCAGGTTCAATGTGGCTTAATTCTCGAGAATTAAGCCACATTGAACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052865.2-1338s1c1
Sequence:CCGGGCTACCTCTTATTTACCTGAACTCGAGTTCAGGTAAATAAGAGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052865.2-922s1c1
Sequence:CCGGCCATGATACCAACTACAGCTTCTCGAGAAGCTGTAGTTGGTATCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129212    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052865.2-1330s1c1
Sequence:CCGGCCAGCTATGCTACCTCTTATTCTCGAGAATAAGAGGTAGCATAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052865.2-1451s1c1
Sequence:CCGGCCCAGTCTTTGAGCTGAGATTCTCGAGAATCTCAGCTCAAAGACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052865.2-328s1c1
Sequence:CCGGGAGCAAGCATAAGCTGCCAAACTCGAGTTTGGCAGCTTATGCTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052865.2-816s1c1
Sequence:CCGGGCAAGCTCTGTGTGATTGATTCTCGAGAATCAATCACACAGAGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052865.2-755s1c1
Sequence:CCGGGCTGTTCAACATGAAACCTTACTCGAGTAAGGTTTCATGTTGAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052865
MGME1 MISSION shRNA shRNA Plasmid DNA
mitochondrial genome maintenance exonuclease 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000146894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052865.2-1052s1c1
Sequence:CCGGCGACTAGAAGAATATACGGAACTCGAGTTCCGTATATTCTTCTAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052865.2-944s1c1
Sequence:CCGGCAGGTTCAATGTGGCTTAATTCTCGAGAATTAAGCCACATTGAACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052865.2-1338s1c1
Sequence:CCGGGCTACCTCTTATTTACCTGAACTCGAGTTCAGGTAAATAAGAGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052865.2-922s1c1
Sequence:CCGGCCATGATACCAACTACAGCTTCTCGAGAAGCTGTAGTTGGTATCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129212    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052865.2-1330s1c1
Sequence:CCGGCCAGCTATGCTACCTCTTATTCTCGAGAATAAGAGGTAGCATAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052865.2-1451s1c1
Sequence:CCGGCCCAGTCTTTGAGCTGAGATTCTCGAGAATCTCAGCTCAAAGACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052865.2-328s1c1
Sequence:CCGGGAGCAAGCATAAGCTGCCAAACTCGAGTTTGGCAGCTTATGCTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052865.2-816s1c1
Sequence:CCGGGCAAGCTCTGTGTGATTGATTCTCGAGAATCAATCACACAGAGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052865.2-755s1c1
Sequence:CCGGGCTGTTCAACATGAAACCTTACTCGAGTAAGGTTTCATGTTGAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052865
MGME1 MISSION shRNA Lentiviral Transduction Particles
mitochondrial genome maintenance exonuclease 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000146894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052865.2-1052s1c1
Sequence:CCGGCGACTAGAAGAATATACGGAACTCGAGTTCCGTATATTCTTCTAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052865.2-944s1c1
Sequence:CCGGCAGGTTCAATGTGGCTTAATTCTCGAGAATTAAGCCACATTGAACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052865.2-1338s1c1
Sequence:CCGGGCTACCTCTTATTTACCTGAACTCGAGTTCAGGTAAATAAGAGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052865.2-922s1c1
Sequence:CCGGCCATGATACCAACTACAGCTTCTCGAGAAGCTGTAGTTGGTATCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129212    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052865.2-1330s1c1
Sequence:CCGGCCAGCTATGCTACCTCTTATTCTCGAGAATAAGAGGTAGCATAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052865.2-1451s1c1
Sequence:CCGGCCCAGTCTTTGAGCTGAGATTCTCGAGAATCTCAGCTCAAAGACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052865.2-328s1c1
Sequence:CCGGGAGCAAGCATAAGCTGCCAAACTCGAGTTTGGCAGCTTATGCTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052865.2-816s1c1
Sequence:CCGGGCAAGCTCTGTGTGATTGATTCTCGAGAATCAATCACACAGAGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052865.2-755s1c1
Sequence:CCGGGCTGTTCAACATGAAACCTTACTCGAGTAAGGTTTCATGTTGAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)