EMAIL THIS PAGE TO A FRIEND

MGMT

O-6-methylguanine-DNA methyltransferase

68 Gene Product Result for
UniProtKB ID: P16455, Q5VY78
Gene ID:
Mouse(17314) O-6-methylguanine-DNA methyltransferase
Rat(25332) O-6-methylguanine-DNA methyltransferase
domestic guinea pig(100733185) O-6-methylguanine-DNA methyltransferase
naked mole-rat(101714788) O-6-methylguanine-DNA methyltransferase
sheep(101106897) O-6-methylguanine-DNA methyltransferase
Zebrafish(553368) O-6-methylguanine-DNA methyltransferase
chicken(423965) O-6-methylguanine-DNA methyltransferase
cow(616091) O-6-methylguanine-DNA methyltransferase
domestic cat(101085076) O-6-methylguanine-DNA methyltransferase
dog(442978) O-6-methylguanine-DNA methyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008598 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008598 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008598 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002412 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002412 Rosetta Predictions human pricing
NM_012861 Rosetta Predictions rat pricing
NM_008598 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106796 predicted 451
2 SASI_Hs01_00106797 predicted 377
3 SASI_Hs01_00106798 predicted 325
4 SASI_Hs01_00106799 predicted 620
5 SASI_Hs01_00106800 predicted 417
6 SASI_Hs01_00106801 predicted 403
7 SASI_Hs01_00106802 predicted 400
8 SASI_Hs01_00106803 predicted 415
9 SASI_Hs01_00106804 predicted 408
10 SASI_Hs01_00106805 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012861 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054531 predicted 402
2 SASI_Rn01_00054532 predicted 338
3 SASI_Rn01_00054533 predicted 367
4 SASI_Rn01_00054534 predicted 410
5 SASI_Rn01_00054535 predicted 450
6 SASI_Rn02_00260347 predicted 275
7 SASI_Rn01_00054537 predicted 391
8 SASI_Rn01_00054538 predicted 473
9 SASI_Rn01_00054539 predicted 569
10 SASI_Rn01_00054540 predicted 347
11 SASI_Rn01_00054536 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008598 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314248 predicted 428
2 SASI_Mm01_00190681 predicted 417
3 SASI_Mm02_00314249 predicted 376
4 SASI_Mm02_00314250 predicted 289
5 SASI_Mm01_00190683 predicted 483
6 SASI_Mm01_00190685 predicted 467
7 SASI_Mm02_00314251 predicted 422
8 SASI_Mm01_00190686 predicted 362
9 SASI_Mm01_00190687 predicted 421
10 SASI_Mm01_00190688 predicted 391
11 SASI_Mm01_00190679 predicted 700
12 SASI_Mm01_00190680 predicted 700
13 SASI_Mm01_00190682 predicted 644
14 SASI_Mm01_00190684 predicted 672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008598
MGMT MISSION shRNA Bacterial Glycerol Stock
O-6-methylguanine-DNA methyltransferase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039084    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008598.1-759s1c1
Sequence:CCGGCCCTTTCTTGTTTCTACATTTCTCGAGAAATGTAGAAACAAGAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008598.1-330s1c1
Sequence:CCGGGCTGCTGAAGGTTGTGAAATTCTCGAGAATTTCACAACCTTCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008598.1-652s1c1
Sequence:CCGGGTAACCGTTTGAATGACACATCTCGAGATGTGTCATTCAAACGGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008598.1-358s1c1
Sequence:CCGGACGGTTTCTTACCAGCAATTACTCGAGTAATTGCTGGTAAGAAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008598.2-487s21c1
Sequence:CCGGCAGTAGGAGGAGCAATGAGAACTCGAGTTCTCATTGCTCCTCCTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008598.2-554s21c1
Sequence:CCGGTGACGGTGCCATCGGCCATTACTCGAGTAATGGCCGATGGCACCGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008598.2-704s21c1
Sequence:CCGGTGAGCCGTCTGGCCGAAATTGCTCGAGCAATTTCGGCCAGACGGCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008598.2-363s21c1
Sequence:CCGGGTGTTCCAGCAAGATTCATTCCTCGAGGAATGAATCTTGCTGGAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008598
MGMT MISSION shRNA shRNA Plasmid DNA
O-6-methylguanine-DNA methyltransferase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039084    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008598.1-759s1c1
Sequence:CCGGCCCTTTCTTGTTTCTACATTTCTCGAGAAATGTAGAAACAAGAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008598.1-330s1c1
Sequence:CCGGGCTGCTGAAGGTTGTGAAATTCTCGAGAATTTCACAACCTTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008598.1-652s1c1
Sequence:CCGGGTAACCGTTTGAATGACACATCTCGAGATGTGTCATTCAAACGGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008598.1-358s1c1
Sequence:CCGGACGGTTTCTTACCAGCAATTACTCGAGTAATTGCTGGTAAGAAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008598.2-487s21c1
Sequence:CCGGCAGTAGGAGGAGCAATGAGAACTCGAGTTCTCATTGCTCCTCCTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008598.2-554s21c1
Sequence:CCGGTGACGGTGCCATCGGCCATTACTCGAGTAATGGCCGATGGCACCGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008598.2-704s21c1
Sequence:CCGGTGAGCCGTCTGGCCGAAATTGCTCGAGCAATTTCGGCCAGACGGCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008598.2-363s21c1
Sequence:CCGGGTGTTCCAGCAAGATTCATTCCTCGAGGAATGAATCTTGCTGGAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008598
MGMT MISSION shRNA Lentiviral Transduction Particles
O-6-methylguanine-DNA methyltransferase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039084    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008598.1-759s1c1
Sequence:CCGGCCCTTTCTTGTTTCTACATTTCTCGAGAAATGTAGAAACAAGAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008598.1-330s1c1
Sequence:CCGGGCTGCTGAAGGTTGTGAAATTCTCGAGAATTTCACAACCTTCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008598.1-652s1c1
Sequence:CCGGGTAACCGTTTGAATGACACATCTCGAGATGTGTCATTCAAACGGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008598.1-358s1c1
Sequence:CCGGACGGTTTCTTACCAGCAATTACTCGAGTAATTGCTGGTAAGAAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008598.2-487s21c1
Sequence:CCGGCAGTAGGAGGAGCAATGAGAACTCGAGTTCTCATTGCTCCTCCTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008598.2-554s21c1
Sequence:CCGGTGACGGTGCCATCGGCCATTACTCGAGTAATGGCCGATGGCACCGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008598.2-704s21c1
Sequence:CCGGTGAGCCGTCTGGCCGAAATTGCTCGAGCAATTTCGGCCAGACGGCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008598.2-363s21c1
Sequence:CCGGGTGTTCCAGCAAGATTCATTCCTCGAGGAATGAATCTTGCTGGAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002412
MGMT MISSION shRNA Bacterial Glycerol Stock
O-6-methylguanine-DNA methyltransferase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022364    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_002412.1-739s1c1
Sequence:CCGGGCTGTATTAAAGGAAGTGGCACTCGAGTGCCACTTCCTTTAATACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022366    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_002412.1-378s1c1
Sequence:CCGGCTTACCAGCAATTAGCAGCCCCTCGAGGGGCTGCTAATTGCTGGTAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022368    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_002412.1-431s1c1
Sequence:CCGGGGAGGAGCAATGAGAGGCAATCTCGAGATTGCCTCTCATTGCTCCTCCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002412.1-379s1c1
Sequence:CCGGTTACCAGCAATTAGCAGCCCTCTCGAGAGGGCTGCTAATTGCTGGTAATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022365    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_002412.1-377s1c1
Sequence:CCGGTCTTACCAGCAATTAGCAGCCCTCGAGGGCTGCTAATTGCTGGTAAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002412.3-308s21c1
Sequence:CCGGAGCCTGGCTGAATGCCTATTTCTCGAGAAATAGGCATTCAGCCAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002412.3-767s21c1
Sequence:CCGGTGAGCGACACACACGTGTAACCTCGAGGTTACACGTGTGTGTCGCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002412.3-192s21c1
Sequence:CCGGGAGCAGGGTCTGCACGAAATACTCGAGTATTTCGTGCAGACCCTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002412.3-937s21c1
Sequence:CCGGTAACGCTGCCCTTGCTCTATTCTCGAGAATAGAGCAAGGGCAGCGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002412
MGMT MISSION shRNA shRNA Plasmid DNA
O-6-methylguanine-DNA methyltransferase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022364    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_002412.1-739s1c1
Sequence:CCGGGCTGTATTAAAGGAAGTGGCACTCGAGTGCCACTTCCTTTAATACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022366    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_002412.1-378s1c1
Sequence:CCGGCTTACCAGCAATTAGCAGCCCCTCGAGGGGCTGCTAATTGCTGGTAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022368    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_002412.1-431s1c1
Sequence:CCGGGGAGGAGCAATGAGAGGCAATCTCGAGATTGCCTCTCATTGCTCCTCCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002412.1-379s1c1
Sequence:CCGGTTACCAGCAATTAGCAGCCCTCTCGAGAGGGCTGCTAATTGCTGGTAATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022365    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_002412.1-377s1c1
Sequence:CCGGTCTTACCAGCAATTAGCAGCCCTCGAGGGCTGCTAATTGCTGGTAAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002412.3-308s21c1
Sequence:CCGGAGCCTGGCTGAATGCCTATTTCTCGAGAAATAGGCATTCAGCCAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002412.3-767s21c1
Sequence:CCGGTGAGCGACACACACGTGTAACCTCGAGGTTACACGTGTGTGTCGCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002412.3-192s21c1
Sequence:CCGGGAGCAGGGTCTGCACGAAATACTCGAGTATTTCGTGCAGACCCTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002412.3-937s21c1
Sequence:CCGGTAACGCTGCCCTTGCTCTATTCTCGAGAATAGAGCAAGGGCAGCGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002412
MGMT MISSION shRNA Lentiviral Transduction Particles
O-6-methylguanine-DNA methyltransferase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022364    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_002412.1-739s1c1
Sequence:CCGGGCTGTATTAAAGGAAGTGGCACTCGAGTGCCACTTCCTTTAATACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022366    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_002412.1-378s1c1
Sequence:CCGGCTTACCAGCAATTAGCAGCCCCTCGAGGGGCTGCTAATTGCTGGTAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022368    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_002412.1-431s1c1
Sequence:CCGGGGAGGAGCAATGAGAGGCAATCTCGAGATTGCCTCTCATTGCTCCTCCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002412.1-379s1c1
Sequence:CCGGTTACCAGCAATTAGCAGCCCTCTCGAGAGGGCTGCTAATTGCTGGTAATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022365    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_002412.1-377s1c1
Sequence:CCGGTCTTACCAGCAATTAGCAGCCCTCGAGGGCTGCTAATTGCTGGTAAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002412.3-308s21c1
Sequence:CCGGAGCCTGGCTGAATGCCTATTTCTCGAGAAATAGGCATTCAGCCAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419534    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002412.3-767s21c1
Sequence:CCGGTGAGCGACACACACGTGTAACCTCGAGGTTACACGTGTGTGTCGCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002412.3-192s21c1
Sequence:CCGGGAGCAGGGTCTGCACGAAATACTCGAGTATTTCGTGCAGACCCTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002412.3-937s21c1
Sequence:CCGGTAACGCTGCCCTTGCTCTATTCTCGAGAATAGAGCAAGGGCAGCGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)