EMAIL THIS PAGE TO A FRIEND

MGP

matrix Gla protein

78 Gene Product Result for
Synonyms: MGLAP NTI
Gene ID:
Human(4256) Summary: The protein encoded by this gene is secreted and likely acts as an inhibitor of bone formation. The encoded protein is found in the organic matrix of bone and cartilage. Defects in this gene are a cause of Keutel syndrome (KS). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Mouse(17313) matrix Gla protein
Rat(25333) matrix Gla protein
Zebrafish(402937) matrix Gla protein
Thale Cress(839396) zinc finger protein MAGPIE
chicken(395912) matrix Gla protein
cow(282660) matrix Gla protein
domestic cat(101096741) matrix Gla protein
dog(611039) matrix Gla protein
sheep(101106925) matrix Gla protein
naked mole-rat(101718542) matrix Gla protein
Domestic Rabbit(100008989) matrix Gla protein
domestic guinea pig(100734539) matrix Gla protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000900 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000900 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000900 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008597 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008597 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008597 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000900 Rosetta Predictions human pricing
NM_012862 Rosetta Predictions rat pricing
NM_008597 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081601 predicted 198
2 SASI_Hs01_00081599 predicted 199
3 SASI_Hs01_00081600 predicted 199
4 SASI_Hs01_00081602 predicted 180
5 SASI_Hs01_00081603 predicted 512
6 SASI_Hs01_00081604 predicted 139
7 SASI_Hs01_00081605 predicted 607
8 SASI_Hs01_00081606 predicted 270
9 SASI_Hs01_00081607 predicted 561
10 SASI_Hs01_00081608 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012862 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048812 predicted 280
2 SASI_Rn01_00048813 predicted 214
3 SASI_Rn01_00048814 predicted 251
4 SASI_Rn01_00048815 predicted 198
5 SASI_Rn01_00048816 predicted 269
6 SASI_Rn01_00048817 predicted 241
7 SASI_Rn01_00048818 predicted 249
8 SASI_Rn01_00048819 predicted 278
9 SASI_Rn01_00048820 predicted 267
10 SASI_Rn01_00048821 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182019 predicted 367
2 SASI_Mm01_00182020 predicted 364
3 SASI_Mm02_00314246 predicted 280
4 SASI_Mm02_00314247 predicted 298
5 SASI_Mm01_00182022 predicted 368
6 SASI_Mm01_00182023 predicted 361
7 SASI_Mm01_00182024 predicted 241
8 SASI_Mm01_00182026 predicted 284
9 SASI_Mm01_00182027 predicted 261
10 SASI_Mm01_00182028 predicted 262
11 SASI_Mm01_00182021 predicted 346
12 SASI_Mm01_00182025 predicted 383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000900
MGP MISSION shRNA Bacterial Glycerol Stock
matrix Gla protein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000900.2-491s21c1
Sequence:CCGGCTGAAATACATAGGCTTATATCTCGAGATATAAGCCTATGTATTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000900.2-291s21c1
Sequence:CCGGAGCCTGTCCACGAGCTCAATACTCGAGTATTGAGCTCGTGGACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000900.1-86s1c1
Sequence:CCGGGCGGTAGTAACTTTGTGTTATCTCGAGATAACACAAAGTTACTACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000900.1-292s1c1
Sequence:CCGGCGCCATGGTTTATGGATACAACTCGAGTTGTATCCATAAACCATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000900.1-113s1c1
Sequence:CCGGCATGAAAGCATGGAATCTTATCTCGAGATAAGATTCCATGCTTTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000900.1-271s1c1
Sequence:CCGGCTACAGACTTTGCGAACGCTACTCGAGTAGCGTTCGCAAAGTCTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000900.1-143s1c1
Sequence:CCGGCCCTTCATTAACAGGAGAAATCTCGAGATTTCTCCTGTTAATGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000900
MGP MISSION shRNA shRNA Plasmid DNA
matrix Gla protein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000900.2-491s21c1
Sequence:CCGGCTGAAATACATAGGCTTATATCTCGAGATATAAGCCTATGTATTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000900.2-291s21c1
Sequence:CCGGAGCCTGTCCACGAGCTCAATACTCGAGTATTGAGCTCGTGGACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000900.1-86s1c1
Sequence:CCGGGCGGTAGTAACTTTGTGTTATCTCGAGATAACACAAAGTTACTACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000900.1-292s1c1
Sequence:CCGGCGCCATGGTTTATGGATACAACTCGAGTTGTATCCATAAACCATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000900.1-113s1c1
Sequence:CCGGCATGAAAGCATGGAATCTTATCTCGAGATAAGATTCCATGCTTTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000900.1-271s1c1
Sequence:CCGGCTACAGACTTTGCGAACGCTACTCGAGTAGCGTTCGCAAAGTCTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000900.1-143s1c1
Sequence:CCGGCCCTTCATTAACAGGAGAAATCTCGAGATTTCTCCTGTTAATGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000900
MGP MISSION shRNA Lentiviral Transduction Particles
matrix Gla protein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000900.2-491s21c1
Sequence:CCGGCTGAAATACATAGGCTTATATCTCGAGATATAAGCCTATGTATTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000900.2-291s21c1
Sequence:CCGGAGCCTGTCCACGAGCTCAATACTCGAGTATTGAGCTCGTGGACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000900.1-86s1c1
Sequence:CCGGGCGGTAGTAACTTTGTGTTATCTCGAGATAACACAAAGTTACTACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000900.1-292s1c1
Sequence:CCGGCGCCATGGTTTATGGATACAACTCGAGTTGTATCCATAAACCATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000900.1-113s1c1
Sequence:CCGGCATGAAAGCATGGAATCTTATCTCGAGATAAGATTCCATGCTTTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000900.1-271s1c1
Sequence:CCGGCTACAGACTTTGCGAACGCTACTCGAGTAGCGTTCGCAAAGTCTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000900.1-143s1c1
Sequence:CCGGCCCTTCATTAACAGGAGAAATCTCGAGATTTCTCCTGTTAATGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008597
VALIDATED
MGP MISSION shRNA Bacterial Glycerol Stock
matrix Gla protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008597.3-342s21c1
Sequence:CCGGCGCTGCCTACAACCGCTACTTCTCGAGAAGTAGCGGTTGTAGGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008597.3-132s21c1
Sequence:CCGGCTACGAATCTCACGAAAGCATCTCGAGATGCTTTCGTGAGATTCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008597.3-156s21c1
Sequence:CCGGGTCCTATGAAATCAGTCCCTTCTCGAGAAGGGACTGATTTCATAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008597.3-438s21c1
Sequence:CCGGGCAGTAGCATTACTGAAGTATCTCGAGATACTTCAGTAATGCTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008597.3-369s21c1
Sequence:CCGGGCGCCGAGGAGCCAAATATTACTCGAGTAATATTTGGCTCCTCGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008597.2-173s1c1
Sequence:CCGGCCCTTCATCAACAGGAGAAATCTCGAGATTTCTCCTGTTGATGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008597.2-439s1c1
Sequence:CCGGGCAGTAGCATTACTGAAGTATCTCGAGATACTTCAGTAATGCTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008597.2-133s1c1
Sequence:CCGGCTACGAATCTCACGAAAGCATCTCGAGATGCTTTCGTGAGATTCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008597.2-343s1c1
Sequence:CCGGCGCTGCCTACAACCGCTACTTCTCGAGAAGTAGCGGTTGTAGGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008597.2-157s1c1
Sequence:CCGGGTCCTATGAAATCAGTCCCTTCTCGAGAAGGGACTGATTTCATAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008597
VALIDATED
MGP MISSION shRNA shRNA Plasmid DNA
matrix Gla protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008597.3-342s21c1
Sequence:CCGGCGCTGCCTACAACCGCTACTTCTCGAGAAGTAGCGGTTGTAGGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008597.3-132s21c1
Sequence:CCGGCTACGAATCTCACGAAAGCATCTCGAGATGCTTTCGTGAGATTCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008597.3-156s21c1
Sequence:CCGGGTCCTATGAAATCAGTCCCTTCTCGAGAAGGGACTGATTTCATAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008597.3-438s21c1
Sequence:CCGGGCAGTAGCATTACTGAAGTATCTCGAGATACTTCAGTAATGCTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008597.3-369s21c1
Sequence:CCGGGCGCCGAGGAGCCAAATATTACTCGAGTAATATTTGGCTCCTCGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008597.2-173s1c1
Sequence:CCGGCCCTTCATCAACAGGAGAAATCTCGAGATTTCTCCTGTTGATGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008597.2-439s1c1
Sequence:CCGGGCAGTAGCATTACTGAAGTATCTCGAGATACTTCAGTAATGCTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008597.2-133s1c1
Sequence:CCGGCTACGAATCTCACGAAAGCATCTCGAGATGCTTTCGTGAGATTCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008597.2-343s1c1
Sequence:CCGGCGCTGCCTACAACCGCTACTTCTCGAGAAGTAGCGGTTGTAGGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008597.2-157s1c1
Sequence:CCGGGTCCTATGAAATCAGTCCCTTCTCGAGAAGGGACTGATTTCATAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008597
VALIDATED
MGP MISSION shRNA Lentiviral Transduction Particles
matrix Gla protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008597.3-342s21c1
Sequence:CCGGCGCTGCCTACAACCGCTACTTCTCGAGAAGTAGCGGTTGTAGGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008597.3-132s21c1
Sequence:CCGGCTACGAATCTCACGAAAGCATCTCGAGATGCTTTCGTGAGATTCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008597.3-156s21c1
Sequence:CCGGGTCCTATGAAATCAGTCCCTTCTCGAGAAGGGACTGATTTCATAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008597.3-438s21c1
Sequence:CCGGGCAGTAGCATTACTGAAGTATCTCGAGATACTTCAGTAATGCTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008597.3-369s21c1
Sequence:CCGGGCGCCGAGGAGCCAAATATTACTCGAGTAATATTTGGCTCCTCGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008597.2-173s1c1
Sequence:CCGGCCCTTCATCAACAGGAGAAATCTCGAGATTTCTCCTGTTGATGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008597.2-439s1c1
Sequence:CCGGGCAGTAGCATTACTGAAGTATCTCGAGATACTTCAGTAATGCTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008597.2-133s1c1
Sequence:CCGGCTACGAATCTCACGAAAGCATCTCGAGATGCTTTCGTGAGATTCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008597.2-343s1c1
Sequence:CCGGCGCTGCCTACAACCGCTACTTCTCGAGAAGTAGCGGTTGTAGGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008597.2-157s1c1
Sequence:CCGGGTCCTATGAAATCAGTCCCTTCTCGAGAAGGGACTGATTTCATAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)