EMAIL THIS PAGE TO A FRIEND

MGRN1

mahogunin ring finger 1, E3 ubiquitin protein ligase

69 Gene Product Result for
Synonyms: RNF156
UniProtKB ID: O60291, A4URL3, A4URL4, Q86W76
Gene ID:
Human(23295) Summary: Mahogunin (MGRN1) is a C3HC4 RING-containing protein with E3 ubiquitin ligase activity in vitro.[supplied by OMIM, Apr 2004]
Mouse(17237) mahogunin, ring finger 1
Rat(302938) mahogunin ring finger 1, E3 ubiquitin protein ligase
chicken(416660) mahogunin, ring finger 1
domestic cat(101093485) mahogunin ring finger 1, E3 ubiquitin protein ligase
cow(616130) mahogunin ring finger 1, E3 ubiquitin protein ligase
dog(479863) mahogunin ring finger 1, E3 ubiquitin protein ligase
Goat(100861057) mahogunin ring finger 1, E3 ubiquitin protein ligase
sheep(101103032) mahogunin ring finger 1, E3 ubiquitin protein ligase
domestic guinea pig(100720916) mahogunin ring finger 1, E3 ubiquitin protein ligase
Domestic Rabbit(100342669) mahogunin ring finger 1, E3 ubiquitin protein ligase
naked mole-rat(101726363) mahogunin ring finger 1, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029657 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029657 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029657 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015246 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015246 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015246 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015246 Rosetta Predictions human pricing
NM_001013964 Rosetta Predictions rat pricing
NM_029657 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035676 predicted 658
2 SASI_Hs01_00035677 predicted 2061
3 SASI_Hs01_00035678 predicted 1959
4 SASI_Hs01_00035679 predicted 1967
5 SASI_Hs01_00035680 predicted 723
6 SASI_Hs01_00035683 predicted 684
7 SASI_Hs01_00035684 predicted 620
8 SASI_Hs01_00035685 predicted 307
9 SASI_Hs02_00347381 predicted 1349
10 SASI_Hs02_00347382 predicted 195
11 SASI_Hs01_00035681 predicted 771
12 SASI_Hs01_00035682 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119452 predicted 497
2 SASI_Rn01_00119453 predicted 1607
3 SASI_Rn02_00201288 predicted 1298
4 SASI_Rn01_00119454 predicted 712
5 SASI_Rn01_00119455 predicted 922
6 SASI_Rn01_00119456 predicted 1215
7 SASI_Rn01_00119457 predicted 1183
8 SASI_Rn01_00119458 predicted 855
9 SASI_Rn02_00201289 predicted 587
10 SASI_Rn01_00119459 predicted 978
11 SASI_Rn01_00119460 predicted 1446
12 SASI_Rn01_00119461 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029657 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113430 predicted 404
2 SASI_Mm01_00113431 predicted 1204
3 SASI_Mm01_00113432 predicted 525
4 SASI_Mm01_00113433 predicted 1608
5 SASI_Mm01_00113434 predicted 1560
6 SASI_Mm01_00113435 predicted 1298
7 SASI_Mm01_00113436 predicted 1189
8 SASI_Mm01_00113437 predicted 1214
9 SASI_Mm01_00113438 predicted 854
10 SASI_Mm01_00113439 predicted 524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029657
VALIDATED
MGRN1 MISSION shRNA Bacterial Glycerol Stock
mahogunin ring finger 1, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029657.2-1194s1c1
Sequence:CCGGGCACTCTAGTTCTGACAGTATCTCGAGATACTGTCAGAACTAGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029657.2-224s1c1
Sequence:CCGGGAAACTACTTTGCTTCGCATTCTCGAGAATGCGAAGCAAAGTAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029657.2-654s1c1
Sequence:CCGGGCCTTCTTTCAAGATTGACTTCTCGAGAAGTCAATCTTGAAAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029657.2-480s1c1
Sequence:CCGGCGTGCTCTACAGTCTGGAATTCTCGAGAATTCCAGACTGTAGAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029657.2-897s1c1
Sequence:CCGGCGGCATCGAGAACAAGAACAACTCGAGTTGTTCTTGTTCTCGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029657
VALIDATED
MGRN1 MISSION shRNA shRNA Plasmid DNA
mahogunin ring finger 1, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029657.2-1194s1c1
Sequence:CCGGGCACTCTAGTTCTGACAGTATCTCGAGATACTGTCAGAACTAGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029657.2-224s1c1
Sequence:CCGGGAAACTACTTTGCTTCGCATTCTCGAGAATGCGAAGCAAAGTAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029657.2-654s1c1
Sequence:CCGGGCCTTCTTTCAAGATTGACTTCTCGAGAAGTCAATCTTGAAAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029657.2-480s1c1
Sequence:CCGGCGTGCTCTACAGTCTGGAATTCTCGAGAATTCCAGACTGTAGAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029657.2-897s1c1
Sequence:CCGGCGGCATCGAGAACAAGAACAACTCGAGTTGTTCTTGTTCTCGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029657
VALIDATED
MGRN1 MISSION shRNA Lentiviral Transduction Particles
mahogunin ring finger 1, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029657.2-1194s1c1
Sequence:CCGGGCACTCTAGTTCTGACAGTATCTCGAGATACTGTCAGAACTAGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029657.2-224s1c1
Sequence:CCGGGAAACTACTTTGCTTCGCATTCTCGAGAATGCGAAGCAAAGTAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029657.2-654s1c1
Sequence:CCGGGCCTTCTTTCAAGATTGACTTCTCGAGAAGTCAATCTTGAAAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029657.2-480s1c1
Sequence:CCGGCGTGCTCTACAGTCTGGAATTCTCGAGAATTCCAGACTGTAGAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029657.2-897s1c1
Sequence:CCGGCGGCATCGAGAACAAGAACAACTCGAGTTGTTCTTGTTCTCGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015246
MGRN1 MISSION shRNA Bacterial Glycerol Stock
mahogunin ring finger 1, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015246.1-2994s1c1
Sequence:CCGGCCCTTGCAGTTCTCTCTGATTCTCGAGAATCAGAGAGAACTGCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015246.1-1586s1c1
Sequence:CCGGCCTGAGAGTTTCATAACAGAACTCGAGTTCTGTTATGAAACTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015246.1-640s1c1
Sequence:CCGGGATTGACTTCTCGGAATGGAACTCGAGTTCCATTCCGAGAAGTCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015246.1-196s1c1
Sequence:CCGGCGGAAACTACTTTGCTTCGCACTCGAGTGCGAAGCAAAGTAGTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015246.1-1155s1c1
Sequence:CCGGTGGAGCATGATGAGCACTCTTCTCGAGAAGAGTGCTCATCATGCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015246.2-1613s21c1
Sequence:CCGGCCTGAGAGTTTCATAACAGAACTCGAGTTCTGTTATGAAACTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015246.2-1182s21c1
Sequence:CCGGTGGAGCATGATGAGCACTCTTCTCGAGAAGAGTGCTCATCATGCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015246.2-3023s21c1
Sequence:CCGGCCCTTGCAGTTCTCTCTGATTCTCGAGAATCAGAGAGAACTGCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015246.2-667s21c1
Sequence:CCGGGATTGACTTCTCGGAATGGAACTCGAGTTCCATTCCGAGAAGTCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015246.2-223s21c1
Sequence:CCGGCGGAAACTACTTTGCTTCGCACTCGAGTGCGAAGCAAAGTAGTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015246
MGRN1 MISSION shRNA shRNA Plasmid DNA
mahogunin ring finger 1, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015246.1-2994s1c1
Sequence:CCGGCCCTTGCAGTTCTCTCTGATTCTCGAGAATCAGAGAGAACTGCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015246.1-1586s1c1
Sequence:CCGGCCTGAGAGTTTCATAACAGAACTCGAGTTCTGTTATGAAACTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015246.1-640s1c1
Sequence:CCGGGATTGACTTCTCGGAATGGAACTCGAGTTCCATTCCGAGAAGTCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015246.1-196s1c1
Sequence:CCGGCGGAAACTACTTTGCTTCGCACTCGAGTGCGAAGCAAAGTAGTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015246.1-1155s1c1
Sequence:CCGGTGGAGCATGATGAGCACTCTTCTCGAGAAGAGTGCTCATCATGCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015246.2-1613s21c1
Sequence:CCGGCCTGAGAGTTTCATAACAGAACTCGAGTTCTGTTATGAAACTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015246.2-1182s21c1
Sequence:CCGGTGGAGCATGATGAGCACTCTTCTCGAGAAGAGTGCTCATCATGCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015246.2-3023s21c1
Sequence:CCGGCCCTTGCAGTTCTCTCTGATTCTCGAGAATCAGAGAGAACTGCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015246.2-667s21c1
Sequence:CCGGGATTGACTTCTCGGAATGGAACTCGAGTTCCATTCCGAGAAGTCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015246.2-223s21c1
Sequence:CCGGCGGAAACTACTTTGCTTCGCACTCGAGTGCGAAGCAAAGTAGTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015246
MGRN1 MISSION shRNA Lentiviral Transduction Particles
mahogunin ring finger 1, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015246.1-2994s1c1
Sequence:CCGGCCCTTGCAGTTCTCTCTGATTCTCGAGAATCAGAGAGAACTGCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015246.1-1586s1c1
Sequence:CCGGCCTGAGAGTTTCATAACAGAACTCGAGTTCTGTTATGAAACTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015246.1-640s1c1
Sequence:CCGGGATTGACTTCTCGGAATGGAACTCGAGTTCCATTCCGAGAAGTCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015246.1-196s1c1
Sequence:CCGGCGGAAACTACTTTGCTTCGCACTCGAGTGCGAAGCAAAGTAGTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015246.1-1155s1c1
Sequence:CCGGTGGAGCATGATGAGCACTCTTCTCGAGAAGAGTGCTCATCATGCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015246.2-1613s21c1
Sequence:CCGGCCTGAGAGTTTCATAACAGAACTCGAGTTCTGTTATGAAACTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015246.2-1182s21c1
Sequence:CCGGTGGAGCATGATGAGCACTCTTCTCGAGAAGAGTGCTCATCATGCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015246.2-3023s21c1
Sequence:CCGGCCCTTGCAGTTCTCTCTGATTCTCGAGAATCAGAGAGAACTGCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015246.2-667s21c1
Sequence:CCGGGATTGACTTCTCGGAATGGAACTCGAGTTCCATTCCGAGAAGTCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015246.2-223s21c1
Sequence:CCGGCGGAAACTACTTTGCTTCGCACTCGAGTGCGAAGCAAAGTAGTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)