EMAIL THIS PAGE TO A FRIEND

MGST2

microsomal glutathione S-transferase 2

53 Gene Product Result for
Synonyms: GST2 MGST-II
UniProtKB ID: Q99735, D6RBB5, Q7Z5B8
Gene ID:
Human(4258) Summary: The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, several of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. This gene encodes a protein which catalyzes the conjugation of leukotriene A4 and reduced glutathione to produce leukotriene C4. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2011]
Mouse(211666) microsomal glutathione S-transferase 2
Rat(295037) microsomal glutathione S-transferase 2
sheep(101115574) microsomal glutathione S-transferase 2
domestic guinea pig(100730296) microsomal glutathione S-transferase 2
naked mole-rat(101716174) microsomal glutathione S-transferase 2
Zebrafish(723997) microsomal glutathione S-transferase 2
chicken(770916) microsomal glutathione S-transferase 2
cow(615552) microsomal glutathione S-transferase 2
domestic cat(101090936) microsomal glutathione S-transferase 2
dog(476078) microsomal glutathione S-transferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174995 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174995 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174995 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002413 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002413 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002413 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU076501 MISSION® esiRNA esiRNA human MGST2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002413 Rosetta Predictions human pricing
NM_001106430 Rosetta Predictions rat pricing
NM_174995 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031169 predicted 359
2 SASI_Hs02_00333790 predicted 271
3 SASI_Hs01_00031170 predicted 283
4 SASI_Hs01_00031172 predicted 481
5 SASI_Hs01_00031173 predicted 450
6 SASI_Hs01_00031174 predicted 393
7 SASI_Hs01_00031175 predicted 288
8 SASI_Hs01_00031176 predicted 293
9 SASI_Hs01_00031177 predicted 554
10 SASI_Hs01_00031178 predicted 495
11 SASI_Hs01_00031171 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106430 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218888 predicted 366
2 SASI_Rn02_00218889 predicted 278
3 SASI_Rn02_00218890 predicted 234
4 SASI_Rn02_00218891 predicted 375
5 SASI_Rn02_00218892 predicted 418
6 SASI_Rn02_00218893 predicted 367
7 SASI_Rn02_00218894 predicted 393
8 SASI_Rn02_00218895 predicted 342
9 SASI_Rn02_00218896 predicted 355
10 SASI_Rn02_00218897 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174995 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185304 predicted 259
2 SASI_Mm01_00185305 predicted 254
3 SASI_Mm01_00185306 predicted 259
4 SASI_Mm01_00185307 predicted 229
5 SASI_Mm01_00185309 predicted 261
6 SASI_Mm01_00185310 predicted 262
7 SASI_Mm01_00185311 predicted 191
8 SASI_Mm01_00185312 predicted 315
9 SASI_Mm01_00185313 predicted 261
10 SASI_Mm02_00345535 predicted 358
11 SASI_Mm01_00185308 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174995
VALIDATED
MGST2 MISSION shRNA Bacterial Glycerol Stock
microsomal glutathione S-transferase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174995.1-508s1c1
Sequence:CCGGCCTGAACGAATACCTGGACTTCTCGAGAAGTCCAGGTATTCGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174995.1-373s1c1
Sequence:CCGGGTACATATACGCCCGTCACAACTCGAGTTGTGACGGGCGTATATGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174995.1-150s1c1
Sequence:CCGGCGAGAGAATATTTCGTGCACACTCGAGTGTGCACGAAATATTCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174995.1-62s1c1
Sequence:CCGGGTCAGCAAAGTTATTTCGCTTCTCGAGAAGCGAAATAACTTTGCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174995.1-326s1c1
Sequence:CCGGGCTGGGTGGTACTTCAATCAACTCGAGTTGATTGAAGTACCACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174995.2-131s21c1
Sequence:CCGGGGTCGGACGAGCAAGACTAAACTCGAGTTTAGTCTTGCTCGTCCGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174995.2-233s21c1
Sequence:CCGGTTATCCTGTATTCATCGTAATCTCGAGATTACGATGAATACAGGATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174995.2-446s21c1
Sequence:CCGGCCTGAACGAATACCTGGACTTCTCGAGAAGTCCAGGTATTCGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174995.2-311s21c1
Sequence:CCGGGTACATATACGCCCGTCACAACTCGAGTTGTGACGGGCGTATATGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174995.2-264s21c1
Sequence:CCGGGCTGGGTGGTACTTCAATCAACTCGAGTTGATTGAAGTACCACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174995
VALIDATED
MGST2 MISSION shRNA shRNA Plasmid DNA
microsomal glutathione S-transferase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174995.1-508s1c1
Sequence:CCGGCCTGAACGAATACCTGGACTTCTCGAGAAGTCCAGGTATTCGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174995.1-373s1c1
Sequence:CCGGGTACATATACGCCCGTCACAACTCGAGTTGTGACGGGCGTATATGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174995.1-150s1c1
Sequence:CCGGCGAGAGAATATTTCGTGCACACTCGAGTGTGCACGAAATATTCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174995.1-62s1c1
Sequence:CCGGGTCAGCAAAGTTATTTCGCTTCTCGAGAAGCGAAATAACTTTGCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174995.1-326s1c1
Sequence:CCGGGCTGGGTGGTACTTCAATCAACTCGAGTTGATTGAAGTACCACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174995.2-131s21c1
Sequence:CCGGGGTCGGACGAGCAAGACTAAACTCGAGTTTAGTCTTGCTCGTCCGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174995.2-233s21c1
Sequence:CCGGTTATCCTGTATTCATCGTAATCTCGAGATTACGATGAATACAGGATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174995.2-446s21c1
Sequence:CCGGCCTGAACGAATACCTGGACTTCTCGAGAAGTCCAGGTATTCGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174995.2-311s21c1
Sequence:CCGGGTACATATACGCCCGTCACAACTCGAGTTGTGACGGGCGTATATGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174995.2-264s21c1
Sequence:CCGGGCTGGGTGGTACTTCAATCAACTCGAGTTGATTGAAGTACCACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174995
VALIDATED
MGST2 MISSION shRNA Lentiviral Transduction Particles
microsomal glutathione S-transferase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174995.1-508s1c1
Sequence:CCGGCCTGAACGAATACCTGGACTTCTCGAGAAGTCCAGGTATTCGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174995.1-373s1c1
Sequence:CCGGGTACATATACGCCCGTCACAACTCGAGTTGTGACGGGCGTATATGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174995.1-150s1c1
Sequence:CCGGCGAGAGAATATTTCGTGCACACTCGAGTGTGCACGAAATATTCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174995.1-62s1c1
Sequence:CCGGGTCAGCAAAGTTATTTCGCTTCTCGAGAAGCGAAATAACTTTGCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174995.1-326s1c1
Sequence:CCGGGCTGGGTGGTACTTCAATCAACTCGAGTTGATTGAAGTACCACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174995.2-131s21c1
Sequence:CCGGGGTCGGACGAGCAAGACTAAACTCGAGTTTAGTCTTGCTCGTCCGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174995.2-233s21c1
Sequence:CCGGTTATCCTGTATTCATCGTAATCTCGAGATTACGATGAATACAGGATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174995.2-446s21c1
Sequence:CCGGCCTGAACGAATACCTGGACTTCTCGAGAAGTCCAGGTATTCGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174995.2-311s21c1
Sequence:CCGGGTACATATACGCCCGTCACAACTCGAGTTGTGACGGGCGTATATGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_174995.2-264s21c1
Sequence:CCGGGCTGGGTGGTACTTCAATCAACTCGAGTTGATTGAAGTACCACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002413
VALIDATED
MGST2 MISSION shRNA Bacterial Glycerol Stock
microsomal glutathione S-transferase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002413.3-621s1c1
Sequence:CCGGCCTGGGAATTGCAAACAGCTTCTCGAGAAGCTGTTTGCAATTCCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002413.3-646s1c1
Sequence:CCGGGATGAATATCTGGACCTCAATCTCGAGATTGAGGTCCAGATATTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002413.3-631s1c1
Sequence:CCGGGCAAACAGCTTTCTGGATGAACTCGAGTTCATCCAGAAAGCTGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002413.3-510s1c1
Sequence:CCGGCATATATGGCCGTCACCTATACTCGAGTATAGGTGACGGCCATATATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002413.3-324s1c1
Sequence:CCGGGCAAGTTGGAAAGGCAAGATTCTCGAGAATCTTGCCTTTCCAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002413.3-391s1c1
Sequence:CCGGGAGAGAGTATTTCGGGCACAACTCGAGTTGTGCCCGAAATACTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002413.3-621s21c1
Sequence:CCGGCCTGGGAATTGCAAACAGCTTCTCGAGAAGCTGTTTGCAATTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002413.3-646s21c1
Sequence:CCGGGATGAATATCTGGACCTCAATCTCGAGATTGAGGTCCAGATATTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002413.3-324s21c1
Sequence:CCGGGCAAGTTGGAAAGGCAAGATTCTCGAGAATCTTGCCTTTCCAACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002413.3-510s21c1
Sequence:CCGGCATATATGGCCGTCACCTATACTCGAGTATAGGTGACGGCCATATATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002413
VALIDATED
MGST2 MISSION shRNA shRNA Plasmid DNA
microsomal glutathione S-transferase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002413.3-621s1c1
Sequence:CCGGCCTGGGAATTGCAAACAGCTTCTCGAGAAGCTGTTTGCAATTCCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002413.3-646s1c1
Sequence:CCGGGATGAATATCTGGACCTCAATCTCGAGATTGAGGTCCAGATATTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002413.3-631s1c1
Sequence:CCGGGCAAACAGCTTTCTGGATGAACTCGAGTTCATCCAGAAAGCTGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002413.3-510s1c1
Sequence:CCGGCATATATGGCCGTCACCTATACTCGAGTATAGGTGACGGCCATATATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002413.3-324s1c1
Sequence:CCGGGCAAGTTGGAAAGGCAAGATTCTCGAGAATCTTGCCTTTCCAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002413.3-391s1c1
Sequence:CCGGGAGAGAGTATTTCGGGCACAACTCGAGTTGTGCCCGAAATACTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002413.3-621s21c1
Sequence:CCGGCCTGGGAATTGCAAACAGCTTCTCGAGAAGCTGTTTGCAATTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002413.3-646s21c1
Sequence:CCGGGATGAATATCTGGACCTCAATCTCGAGATTGAGGTCCAGATATTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002413.3-324s21c1
Sequence:CCGGGCAAGTTGGAAAGGCAAGATTCTCGAGAATCTTGCCTTTCCAACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002413.3-510s21c1
Sequence:CCGGCATATATGGCCGTCACCTATACTCGAGTATAGGTGACGGCCATATATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002413
VALIDATED
MGST2 MISSION shRNA Lentiviral Transduction Particles
microsomal glutathione S-transferase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002413.3-621s1c1
Sequence:CCGGCCTGGGAATTGCAAACAGCTTCTCGAGAAGCTGTTTGCAATTCCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002413.3-646s1c1
Sequence:CCGGGATGAATATCTGGACCTCAATCTCGAGATTGAGGTCCAGATATTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002413.3-631s1c1
Sequence:CCGGGCAAACAGCTTTCTGGATGAACTCGAGTTCATCCAGAAAGCTGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002413.3-510s1c1
Sequence:CCGGCATATATGGCCGTCACCTATACTCGAGTATAGGTGACGGCCATATATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002413.3-324s1c1
Sequence:CCGGGCAAGTTGGAAAGGCAAGATTCTCGAGAATCTTGCCTTTCCAACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002413.3-391s1c1
Sequence:CCGGGAGAGAGTATTTCGGGCACAACTCGAGTTGTGCCCGAAATACTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002413.3-621s21c1
Sequence:CCGGCCTGGGAATTGCAAACAGCTTCTCGAGAAGCTGTTTGCAATTCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002413.3-646s21c1
Sequence:CCGGGATGAATATCTGGACCTCAATCTCGAGATTGAGGTCCAGATATTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002413.3-324s21c1
Sequence:CCGGGCAAGTTGGAAAGGCAAGATTCTCGAGAATCTTGCCTTTCCAACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002413.3-510s21c1
Sequence:CCGGCATATATGGCCGTCACCTATACTCGAGTATAGGTGACGGCCATATATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)