EMAIL THIS PAGE TO A FRIEND

MGST3

microsomal glutathione S-transferase 3

64 Gene Product Result for
Synonyms: GST-III
UniProtKB ID: O14880, B2R592, Q6ICN4
Gene ID:
Human(4259) Summary: This gene encodes a member of the MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) protein family. Members of this family are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. This gene encodes an enzyme which catalyzes the conjugation of leukotriene A4 and reduced glutathione to produce leukotriene C4. This enzyme also demonstrates glutathione-dependent peroxidase activity towards lipid hydroperoxides.[provided by RefSeq, May 2011]
Mouse(66447) microsomal glutathione S-transferase 3
Rat(289197) microsomal glutathione S-transferase 3
Zebrafish(406736) microsomal glutathione S-transferase 3
chicken(424404) microsomal glutathione S-transferase 3
cow(507346) microsomal glutathione S-transferase 3
domestic cat(101080760) microsomal glutathione S-transferase 3
dog(609050) microsomal glutathione S-transferase 3
naked mole-rat(101717166) microsomal glutathione S-transferase 3
Domestic Rabbit(100008879) microsomal glutathione S-transferase 3
domestic guinea pig(100732012) microsomal glutathione S-transferase 3
Goat(100860758) microsomal glutathione S-transferase 3
sheep(101112365) microsomal glutathione S-transferase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025569 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025569 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025569 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004528 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004528 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004528 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004528 Rosetta Predictions human pricing
XM_001076104 Rosetta Predictions rat pricing
XM_213943 Rosetta Predictions rat pricing
NM_025569 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023773 predicted 353
2 SASI_Hs01_00023774 predicted 284
3 SASI_Hs01_00023776 predicted 362
4 SASI_Hs01_00023777 predicted 234
5 SASI_Hs01_00023778 predicted 318
6 SASI_Hs01_00023779 predicted 263
7 SASI_Hs01_00023780 predicted 356
8 SASI_Hs01_00023781 predicted 364
9 SASI_Hs01_00023782 predicted 329
10 SASI_Hs02_00337825 predicted 194
11 SASI_Hs01_00023775 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352037 predicted 304
2 SASI_Rn02_00352038 predicted 482
3 SASI_Rn02_00352039 predicted 404
4 SASI_Rn02_00352040 predicted 247
5 SASI_Rn02_00352041 predicted 487
6 SASI_Rn02_00352042 predicted 326
7 SASI_Rn02_00352043 predicted 474
8 SASI_Rn02_00352044 predicted 214
9 SASI_Rn02_00352045 predicted 198
10 SASI_Rn02_00352046 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213943 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375026 predicted 298
2 SASI_Rn02_00375027 predicted 484
3 SASI_Rn02_00375028 predicted 397
4 SASI_Rn02_00375029 predicted 250
5 SASI_Rn02_00375030 predicted 492
6 SASI_Rn02_00375031 predicted 321
7 SASI_Rn02_00375032 predicted 479
8 SASI_Rn02_00375033 predicted 207
9 SASI_Rn02_00375034 predicted 198
10 SASI_Rn02_00375035 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025569 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129357 predicted 196
2 SASI_Mm01_00129358 predicted 335
3 SASI_Mm01_00129360 predicted 201
4 SASI_Mm01_00129361 predicted 282
5 SASI_Mm02_00328545 predicted 246
6 SASI_Mm01_00129362 predicted 312
7 SASI_Mm01_00129363 predicted 200
8 SASI_Mm01_00129364 predicted 325
9 SASI_Mm01_00129365 predicted 228
10 SASI_Mm01_00129366 predicted 224
11 SASI_Mm01_00129359 predicted 344
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025569
MGST3 MISSION shRNA Bacterial Glycerol Stock
microsomal glutathione S-transferase 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025569.1-348s21c1
Sequence:CCGGCCTTTACGCATATGGCTACTACTCGAGTAGTAGCCATATGCGTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025569.1-237s21c1
Sequence:CCGGCCAGAACACGTTGGAGGTGTACTCGAGTACACCTCCAACGTGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025569.1-465s21c1
Sequence:CCGGCGGCTGGATCAGACCAGGCTTCTCGAGAAGCCTGGTCTGATCCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025569.1-192s21c1
Sequence:CCGGAGATCCTGAGAACGGGCATATCTCGAGATATGCCCGTTCTCAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025569.1-192s1c1
Sequence:CCGGAGATCCTGAGAACGGGCATATCTCGAGATATGCCCGTTCTCAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025569.1-465s1c1
Sequence:CCGGCGGCTGGATCAGACCAGGCTTCTCGAGAAGCCTGGTCTGATCCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025569.1-237s1c1
Sequence:CCGGCCAGAACACGTTGGAGGTGTACTCGAGTACACCTCCAACGTGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025569.1-348s1c1
Sequence:CCGGCCTTTACGCATATGGCTACTACTCGAGTAGTAGCCATATGCGTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025569
MGST3 MISSION shRNA shRNA Plasmid DNA
microsomal glutathione S-transferase 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025569.1-348s21c1
Sequence:CCGGCCTTTACGCATATGGCTACTACTCGAGTAGTAGCCATATGCGTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025569.1-237s21c1
Sequence:CCGGCCAGAACACGTTGGAGGTGTACTCGAGTACACCTCCAACGTGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025569.1-465s21c1
Sequence:CCGGCGGCTGGATCAGACCAGGCTTCTCGAGAAGCCTGGTCTGATCCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025569.1-192s21c1
Sequence:CCGGAGATCCTGAGAACGGGCATATCTCGAGATATGCCCGTTCTCAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025569.1-192s1c1
Sequence:CCGGAGATCCTGAGAACGGGCATATCTCGAGATATGCCCGTTCTCAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025569.1-465s1c1
Sequence:CCGGCGGCTGGATCAGACCAGGCTTCTCGAGAAGCCTGGTCTGATCCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025569.1-237s1c1
Sequence:CCGGCCAGAACACGTTGGAGGTGTACTCGAGTACACCTCCAACGTGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025569.1-348s1c1
Sequence:CCGGCCTTTACGCATATGGCTACTACTCGAGTAGTAGCCATATGCGTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025569
MGST3 MISSION shRNA Lentiviral Transduction Particles
microsomal glutathione S-transferase 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025569.1-348s21c1
Sequence:CCGGCCTTTACGCATATGGCTACTACTCGAGTAGTAGCCATATGCGTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025569.1-237s21c1
Sequence:CCGGCCAGAACACGTTGGAGGTGTACTCGAGTACACCTCCAACGTGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025569.1-465s21c1
Sequence:CCGGCGGCTGGATCAGACCAGGCTTCTCGAGAAGCCTGGTCTGATCCAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025569.1-192s21c1
Sequence:CCGGAGATCCTGAGAACGGGCATATCTCGAGATATGCCCGTTCTCAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025569.1-192s1c1
Sequence:CCGGAGATCCTGAGAACGGGCATATCTCGAGATATGCCCGTTCTCAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025569.1-465s1c1
Sequence:CCGGCGGCTGGATCAGACCAGGCTTCTCGAGAAGCCTGGTCTGATCCAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025569.1-237s1c1
Sequence:CCGGCCAGAACACGTTGGAGGTGTACTCGAGTACACCTCCAACGTGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025569.1-348s1c1
Sequence:CCGGCCTTTACGCATATGGCTACTACTCGAGTAGTAGCCATATGCGTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004528
VALIDATED
MGST3 MISSION shRNA Bacterial Glycerol Stock
microsomal glutathione S-transferase 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004528.2-284s21c1
Sequence:CCGGGAAGTGTATCCTCCCTTCTTACTCGAGTAAGAAGGGAGGATACACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004528.2-310s21c1
Sequence:CCGGTCTAGCTGTTGGAGGTGTTTACTCGAGTAAACACCTCCAACAGCTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004528.2-271s21c1
Sequence:CCGGCCAGAACACGTTGGAAGTGTACTCGAGTACACTTCCAACGTGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004528.2-186s21c1
Sequence:CCGGGCAAGAAGTACAAAGTGGAGTCTCGAGACTCCACTTTGTACTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004528.2-271s1c1
Sequence:CCGGCCAGAACACGTTGGAAGTGTACTCGAGTACACTTCCAACGTGTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004528.2-186s1c1
Sequence:CCGGGCAAGAAGTACAAAGTGGAGTCTCGAGACTCCACTTTGTACTTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004528.2-378s1c1
Sequence:CCGGGAGTTCTTTATGCTTATGGCTCTCGAGAGCCATAAGCATAAAGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004528.2-196s1c1
Sequence:CCGGCAAAGTGGAGTATCCTATCATCTCGAGATGATAGGATACTCCACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004528.2-284s1c1
Sequence:CCGGGAAGTGTATCCTCCCTTCTTACTCGAGTAAGAAGGGAGGATACACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004528.2-469s1c1
Sequence:CCGGCACAACTGTGTGCTCTGCTTTCTCGAGAAAGCAGAGCACACAGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004528
VALIDATED
MGST3 MISSION shRNA shRNA Plasmid DNA
microsomal glutathione S-transferase 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004528.2-284s21c1
Sequence:CCGGGAAGTGTATCCTCCCTTCTTACTCGAGTAAGAAGGGAGGATACACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004528.2-310s21c1
Sequence:CCGGTCTAGCTGTTGGAGGTGTTTACTCGAGTAAACACCTCCAACAGCTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004528.2-271s21c1
Sequence:CCGGCCAGAACACGTTGGAAGTGTACTCGAGTACACTTCCAACGTGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004528.2-186s21c1
Sequence:CCGGGCAAGAAGTACAAAGTGGAGTCTCGAGACTCCACTTTGTACTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004528.2-271s1c1
Sequence:CCGGCCAGAACACGTTGGAAGTGTACTCGAGTACACTTCCAACGTGTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004528.2-186s1c1
Sequence:CCGGGCAAGAAGTACAAAGTGGAGTCTCGAGACTCCACTTTGTACTTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004528.2-378s1c1
Sequence:CCGGGAGTTCTTTATGCTTATGGCTCTCGAGAGCCATAAGCATAAAGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004528.2-196s1c1
Sequence:CCGGCAAAGTGGAGTATCCTATCATCTCGAGATGATAGGATACTCCACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004528.2-284s1c1
Sequence:CCGGGAAGTGTATCCTCCCTTCTTACTCGAGTAAGAAGGGAGGATACACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004528.2-469s1c1
Sequence:CCGGCACAACTGTGTGCTCTGCTTTCTCGAGAAAGCAGAGCACACAGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004528
VALIDATED
MGST3 MISSION shRNA Lentiviral Transduction Particles
microsomal glutathione S-transferase 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004528.2-284s21c1
Sequence:CCGGGAAGTGTATCCTCCCTTCTTACTCGAGTAAGAAGGGAGGATACACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004528.2-310s21c1
Sequence:CCGGTCTAGCTGTTGGAGGTGTTTACTCGAGTAAACACCTCCAACAGCTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004528.2-271s21c1
Sequence:CCGGCCAGAACACGTTGGAAGTGTACTCGAGTACACTTCCAACGTGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004528.2-186s21c1
Sequence:CCGGGCAAGAAGTACAAAGTGGAGTCTCGAGACTCCACTTTGTACTTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004528.2-271s1c1
Sequence:CCGGCCAGAACACGTTGGAAGTGTACTCGAGTACACTTCCAACGTGTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004528.2-186s1c1
Sequence:CCGGGCAAGAAGTACAAAGTGGAGTCTCGAGACTCCACTTTGTACTTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004528.2-378s1c1
Sequence:CCGGGAGTTCTTTATGCTTATGGCTCTCGAGAGCCATAAGCATAAAGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004528.2-196s1c1
Sequence:CCGGCAAAGTGGAGTATCCTATCATCTCGAGATGATAGGATACTCCACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004528.2-284s1c1
Sequence:CCGGGAAGTGTATCCTCCCTTCTTACTCGAGTAAGAAGGGAGGATACACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004528.2-469s1c1
Sequence:CCGGCACAACTGTGTGCTCTGCTTTCTCGAGAAAGCAGAGCACACAGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)