EMAIL THIS PAGE TO A FRIEND

MIA3

melanoma inhibitory activity family, member 3

343 Gene Product Result for
Synonyms: ARNT D320 TANGO TANGO1 UNQ6077
Gene ID:
Mouse(338366) melanoma inhibitory activity 3
Rat(683007) melanoma inhibitory activity family, member 3
sheep(101102578) melanoma inhibitory activity family, member 3
domestic guinea pig(100713212) melanoma inhibitory activity family, member 3
naked mole-rat(101717069) melanoma inhibitory activity family, member 3
Domestic Rabbit(100351527) melanoma inhibitory activity family, member 3
Zebrafish(567041) melanoma inhibitory activity family, member 3
cow(509133) melanoma inhibitory activity family, member 3
Horse(100055507) melanoma inhibitory activity family, member 3
domestic cat(101097539) melanoma inhibitory activity family, member 3
dog(478997) melanoma inhibitory activity family, member 3
chicken(421337) melanoma inhibitory activity family, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177389 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177389 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177389 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198551 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198551 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198551 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198551 Rosetta Predictions human pricing
XM_496436 Rosetta Predictions human pricing
XM_932515 Rosetta Predictions human pricing
XM_932520 Rosetta Predictions human pricing
XM_932523 Rosetta Predictions human pricing
XM_932525 Rosetta Predictions human pricing
XM_932527 Rosetta Predictions human pricing
XM_932530 Rosetta Predictions human pricing
XM_932535 Rosetta Predictions human pricing
XM_932538 Rosetta Predictions human pricing
XM_932541 Rosetta Predictions human pricing
XM_932544 Rosetta Predictions human pricing
XM_932548 Rosetta Predictions human pricing
XM_001064186 Rosetta Predictions rat pricing
NM_177389 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372156 predicted 4864
2 SASI_Hs02_00372157 predicted 1256
3 SASI_Hs02_00372158 predicted 2006
4 SASI_Hs02_00372159 predicted 2247
5 SASI_Hs02_00372160 predicted 3178
6 SASI_Hs02_00372161 predicted 916
7 SASI_Hs02_00372162 predicted 5640
8 SASI_Hs02_00372163 predicted 4915
9 SASI_Hs02_00372164 predicted 1209
10 SASI_Hs02_00372165 predicted 3898
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267405 predicted 812
2 SASI_Hs01_00267406 predicted 597
3 SASI_Hs01_00267407 predicted 785
4 SASI_Hs01_00267408 predicted 965
5 SASI_Hs01_00267409 predicted 920
6 SASI_Hs01_00267410 predicted 1209
7 SASI_Hs01_00267411 predicted 539
8 SASI_Hs01_00267412 predicted 751
9 SASI_Hs01_00267413 predicted 1030
10 SASI_Hs01_00267414 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00301583 predicted 811
2 SASI_Hs01_00301584 predicted 596
3 SASI_Hs01_00301585 predicted 781
4 SASI_Hs01_00301586 predicted 972
5 SASI_Hs01_00301587 predicted 918
6 SASI_Hs01_00301588 predicted 1199
7 SASI_Hs01_00301589 predicted 540
8 SASI_Hs01_00301590 predicted 751
9 SASI_Hs01_00301591 predicted 1032
10 SASI_Hs01_00301592 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253757 predicted 805
2 SASI_Hs01_00253758 predicted 593
3 SASI_Hs01_00253759 predicted 782
4 SASI_Hs01_00253760 predicted 967
5 SASI_Hs01_00253761 predicted 911
6 SASI_Hs01_00253762 predicted 1208
7 SASI_Hs01_00253763 predicted 547
8 SASI_Hs01_00253764 predicted 757
9 SASI_Hs01_00253765 predicted 1022
10 SASI_Hs01_00253766 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291072 predicted 2236
2 SASI_Hs01_00291073 predicted 2290
3 SASI_Hs01_00291074 predicted 2240
4 SASI_Hs01_00291075 predicted 2234
5 SASI_Hs01_00291076 predicted 2231
6 SASI_Hs01_00291077 predicted 2275
7 SASI_Hs01_00291078 predicted 2239
8 SASI_Hs01_00291079 predicted 2232
9 SASI_Hs01_00291080 predicted 2256
10 SASI_Hs01_00291081 predicted 2288
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268151 predicted 809
2 SASI_Hs01_00268152 predicted 595
3 SASI_Hs01_00268153 predicted 782
4 SASI_Hs01_00268154 predicted 973
5 SASI_Hs01_00268155 predicted 915
6 SASI_Hs01_00268156 predicted 1208
7 SASI_Hs01_00268157 predicted 541
8 SASI_Hs01_00268158 predicted 750
9 SASI_Hs01_00268159 predicted 1026
10 SASI_Hs01_00268160 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256565 predicted 809
2 SASI_Hs01_00256566 predicted 597
3 SASI_Hs01_00256567 predicted 782
4 SASI_Hs01_00256568 predicted 969
5 SASI_Hs01_00256569 predicted 921
6 SASI_Hs01_00256570 predicted 1206
7 SASI_Hs01_00256571 predicted 538
8 SASI_Hs01_00256572 predicted 755
9 SASI_Hs01_00256573 predicted 1029
10 SASI_Hs01_00256574 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287515 predicted 1526
2 SASI_Hs01_00287516 predicted 1723
3 SASI_Hs01_00287517 predicted 1517
4 SASI_Hs01_00287518 predicted 1123
5 SASI_Hs01_00287519 predicted 1349
6 SASI_Hs01_00287520 predicted 1317
7 SASI_Hs01_00287521 predicted 1337
8 SASI_Hs01_00287522 predicted 1217
9 SASI_Hs01_00287523 predicted 1352
10 SASI_Hs01_00287524 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268735 predicted 2603
2 SASI_Hs01_00268736 predicted 2652
3 SASI_Hs01_00268737 predicted 2614
4 SASI_Hs01_00268738 predicted 2598
5 SASI_Hs01_00268739 predicted 2597
6 SASI_Hs01_00268740 predicted 2644
7 SASI_Hs01_00268741 predicted 2610
8 SASI_Hs01_00268742 predicted 2595
9 SASI_Hs01_00268743 predicted 2625
10 SASI_Hs01_00268744 predicted 2658
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289964 predicted 2119
2 SASI_Hs01_00289965 predicted 2168
3 SASI_Hs01_00289966 predicted 2127
4 SASI_Hs01_00289967 predicted 2115
5 SASI_Hs01_00289968 predicted 2115
6 SASI_Hs01_00289969 predicted 2161
7 SASI_Hs01_00289970 predicted 2125
8 SASI_Hs01_00289971 predicted 2107
9 SASI_Hs01_00289972 predicted 2147
10 SASI_Hs01_00289973 predicted 2173
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00301054 predicted 2625
2 SASI_Hs01_00301055 predicted 2675
3 SASI_Hs01_00301056 predicted 2625
4 SASI_Hs01_00301057 predicted 2623
5 SASI_Hs01_00301058 predicted 2619
6 SASI_Hs01_00301059 predicted 2670
7 SASI_Hs01_00301060 predicted 2627
8 SASI_Hs01_00301061 predicted 2613
9 SASI_Hs01_00301062 predicted 2649
10 SASI_Hs01_00301063 predicted 2670
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296604 predicted 812
2 SASI_Hs01_00296605 predicted 592
3 SASI_Hs01_00296606 predicted 781
4 SASI_Hs01_00296607 predicted 966
5 SASI_Hs01_00296608 predicted 911
6 SASI_Hs01_00296609 predicted 1201
7 SASI_Hs01_00296610 predicted 543
8 SASI_Hs01_00296611 predicted 757
9 SASI_Hs01_00296612 predicted 1022
10 SASI_Hs01_00296613 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270262 predicted 2730
2 SASI_Hs01_00270263 predicted 2789
3 SASI_Hs01_00270264 predicted 2738
4 SASI_Hs01_00270265 predicted 2728
5 SASI_Hs01_00270266 predicted 2732
6 SASI_Hs01_00270267 predicted 2775
7 SASI_Hs01_00270268 predicted 2734
8 SASI_Hs01_00270269 predicted 2729
9 SASI_Hs01_00270270 predicted 2761
10 SASI_Hs01_00270271 predicted 2783
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309609 predicted 2975
2 SASI_Rn02_00309610 predicted 4134
3 SASI_Rn02_00309611 predicted 4181
4 SASI_Rn02_00309612 predicted 1034
5 SASI_Rn02_00309613 predicted 4760
6 SASI_Rn02_00309614 predicted 5653
7 SASI_Rn02_00309615 predicted 5028
8 SASI_Rn02_00309616 predicted 773
9 SASI_Rn02_00309617 predicted 2637
10 SASI_Rn02_00309618 predicted 4556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347569 predicted 3037
2 SASI_Mm02_00347570 predicted 4967
3 SASI_Mm02_00347571 predicted 3736
4 SASI_Mm02_00347572 predicted 3709
5 SASI_Mm02_00347573 predicted 4456
6 SASI_Mm02_00347574 predicted 2709
7 SASI_Mm02_00347575 predicted 2693
8 SASI_Mm02_00347576 predicted 3222
9 SASI_Mm02_00347577 predicted 5018
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177389
MIA3 MISSION shRNA Bacterial Glycerol Stock
melanoma inhibitory activity family, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177389.2-1955s1c1
Sequence:CCGGGCGAATGAGAAGACAGGGTTTCTCGAGAAACCCTGTCTTCTCATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177389.2-2722s1c1
Sequence:CCGGGCCTATCATAAACAGCTTCTTCTCGAGAAGAAGCTGTTTATGATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177389.2-691s1c1
Sequence:CCGGGCAGTCTTCGTTGGACACTTTCTCGAGAAAGTGTCCAACGAAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177389.2-2250s1c1
Sequence:CCGGCCCTTAATCTTAACACTGAAACTCGAGTTTCAGTGTTAAGATTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177389.2-3822s1c1
Sequence:CCGGCCCTGGCTGTATTTATTTATTCTCGAGAATAAATAAATACAGCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177389
MIA3 MISSION shRNA shRNA Plasmid DNA
melanoma inhibitory activity family, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177389.2-1955s1c1
Sequence:CCGGGCGAATGAGAAGACAGGGTTTCTCGAGAAACCCTGTCTTCTCATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177389.2-2722s1c1
Sequence:CCGGGCCTATCATAAACAGCTTCTTCTCGAGAAGAAGCTGTTTATGATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177389.2-691s1c1
Sequence:CCGGGCAGTCTTCGTTGGACACTTTCTCGAGAAAGTGTCCAACGAAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177389.2-2250s1c1
Sequence:CCGGCCCTTAATCTTAACACTGAAACTCGAGTTTCAGTGTTAAGATTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177389.2-3822s1c1
Sequence:CCGGCCCTGGCTGTATTTATTTATTCTCGAGAATAAATAAATACAGCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177389
MIA3 MISSION shRNA Lentiviral Transduction Particles
melanoma inhibitory activity family, member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177389.2-1955s1c1
Sequence:CCGGGCGAATGAGAAGACAGGGTTTCTCGAGAAACCCTGTCTTCTCATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177389.2-2722s1c1
Sequence:CCGGGCCTATCATAAACAGCTTCTTCTCGAGAAGAAGCTGTTTATGATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177389.2-691s1c1
Sequence:CCGGGCAGTCTTCGTTGGACACTTTCTCGAGAAAGTGTCCAACGAAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177389.2-2250s1c1
Sequence:CCGGCCCTTAATCTTAACACTGAAACTCGAGTTTCAGTGTTAAGATTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177389.2-3822s1c1
Sequence:CCGGCCCTGGCTGTATTTATTTATTCTCGAGAATAAATAAATACAGCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198551
VALIDATED
MIA3 MISSION shRNA Bacterial Glycerol Stock
melanoma inhibitory activity family, member 3
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000128078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_198551.1-746s1c1
Sequence:CCGGGCAATAGTTCTCAGGTCTCAACTCGAGTTGAGACCTGAGAACTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198551.1-334s1c1
Sequence:CCGGGAGCTACAAGTTCCAACAGATCTCGAGATCTGTTGGAACTTGTAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198551.2-2819s21c1
Sequence:CCGGAGCGGTTCCAGAAGTACTTTACTCGAGTAAAGTACTTCTGGAACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198551.2-925s21c1
Sequence:CCGGGAATTGGATACTGAGTATTATCTCGAGATAATACTCAGTATCCAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198551.2-4445s21c1
Sequence:CCGGGAGCCTCCGTGTCCACTAAATCTCGAGATTTAGTGGACACGGAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198551.1-1051s1c1
Sequence:CCGGCCAACAGATAAAGAGCAGAATCTCGAGATTCTGCTCTTTATCTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198551.1-669s1c1
Sequence:CCGGGCAGGCTTCATTTGAATCTTTCTCGAGAAAGATTCAAATGAAGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198551.1-847s1c1
Sequence:CCGGGCTGATGCACTTGTATCTGATCTCGAGATCAGATACAAGTGCATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198551.1-550s1c1
Sequence:CCGGGCCAACTCAGAGGAAAGTGATCTCGAGATCACTTTCCTCTGAGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198551.1-557s1c1
Sequence:CCGGCAGAGGAAAGTGATAGTGTATCTCGAGATACACTATCACTTTCCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198551.2-2901s21c1
Sequence:CCGGGGAGAGCCTGCCCTATAATATCTCGAGATATTATAGGGCAGGCTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198551.2-7354s21c1
Sequence:CCGGCTATATGTCCTCCCGTTTAATCTCGAGATTAAACGGGAGGACATATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198551.2-784s21c1
Sequence:CCGGGATAAGATTGATGCCTATAAACTCGAGTTTATAGGCATCAATCTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198551.2-3615s21c1
Sequence:CCGGTGTTGTGAAGGATAGAGTATACTCGAGTATACTCTATCCTTCACAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198551.2-4404s21c1
Sequence:CCGGGGTAGTTGAAGAGGATCTAAACTCGAGTTTAGATCCTCTTCAACTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198551.2-6741s21c1
Sequence:CCGGTTAGGACTGTGAGGGTTATAACTCGAGTTATAACCCTCACAGTCCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198551.2-5258s21c1
Sequence:CCGGTCGATGAAGGCAAGGTTAATACTCGAGTATTAACCTTGCCTTCATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198551
VALIDATED
MIA3 MISSION shRNA shRNA Plasmid DNA
melanoma inhibitory activity family, member 3
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000128078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_198551.1-746s1c1
Sequence:CCGGGCAATAGTTCTCAGGTCTCAACTCGAGTTGAGACCTGAGAACTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198551.1-334s1c1
Sequence:CCGGGAGCTACAAGTTCCAACAGATCTCGAGATCTGTTGGAACTTGTAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198551.2-2819s21c1
Sequence:CCGGAGCGGTTCCAGAAGTACTTTACTCGAGTAAAGTACTTCTGGAACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198551.2-925s21c1
Sequence:CCGGGAATTGGATACTGAGTATTATCTCGAGATAATACTCAGTATCCAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198551.2-4445s21c1
Sequence:CCGGGAGCCTCCGTGTCCACTAAATCTCGAGATTTAGTGGACACGGAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198551.1-1051s1c1
Sequence:CCGGCCAACAGATAAAGAGCAGAATCTCGAGATTCTGCTCTTTATCTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198551.1-669s1c1
Sequence:CCGGGCAGGCTTCATTTGAATCTTTCTCGAGAAAGATTCAAATGAAGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198551.1-847s1c1
Sequence:CCGGGCTGATGCACTTGTATCTGATCTCGAGATCAGATACAAGTGCATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198551.1-550s1c1
Sequence:CCGGGCCAACTCAGAGGAAAGTGATCTCGAGATCACTTTCCTCTGAGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198551.1-557s1c1
Sequence:CCGGCAGAGGAAAGTGATAGTGTATCTCGAGATACACTATCACTTTCCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198551.2-2901s21c1
Sequence:CCGGGGAGAGCCTGCCCTATAATATCTCGAGATATTATAGGGCAGGCTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198551.2-7354s21c1
Sequence:CCGGCTATATGTCCTCCCGTTTAATCTCGAGATTAAACGGGAGGACATATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198551.2-784s21c1
Sequence:CCGGGATAAGATTGATGCCTATAAACTCGAGTTTATAGGCATCAATCTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198551.2-3615s21c1
Sequence:CCGGTGTTGTGAAGGATAGAGTATACTCGAGTATACTCTATCCTTCACAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198551.2-4404s21c1
Sequence:CCGGGGTAGTTGAAGAGGATCTAAACTCGAGTTTAGATCCTCTTCAACTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198551.2-6741s21c1
Sequence:CCGGTTAGGACTGTGAGGGTTATAACTCGAGTTATAACCCTCACAGTCCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198551.2-5258s21c1
Sequence:CCGGTCGATGAAGGCAAGGTTAATACTCGAGTATTAACCTTGCCTTCATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198551
VALIDATED
MIA3 MISSION shRNA Lentiviral Transduction Particles
melanoma inhibitory activity family, member 3
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000128078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_198551.1-746s1c1
Sequence:CCGGGCAATAGTTCTCAGGTCTCAACTCGAGTTGAGACCTGAGAACTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198551.1-334s1c1
Sequence:CCGGGAGCTACAAGTTCCAACAGATCTCGAGATCTGTTGGAACTTGTAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198551.2-2819s21c1
Sequence:CCGGAGCGGTTCCAGAAGTACTTTACTCGAGTAAAGTACTTCTGGAACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198551.2-925s21c1
Sequence:CCGGGAATTGGATACTGAGTATTATCTCGAGATAATACTCAGTATCCAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198551.2-4445s21c1
Sequence:CCGGGAGCCTCCGTGTCCACTAAATCTCGAGATTTAGTGGACACGGAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198551.1-1051s1c1
Sequence:CCGGCCAACAGATAAAGAGCAGAATCTCGAGATTCTGCTCTTTATCTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198551.1-669s1c1
Sequence:CCGGGCAGGCTTCATTTGAATCTTTCTCGAGAAAGATTCAAATGAAGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198551.1-847s1c1
Sequence:CCGGGCTGATGCACTTGTATCTGATCTCGAGATCAGATACAAGTGCATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198551.1-550s1c1
Sequence:CCGGGCCAACTCAGAGGAAAGTGATCTCGAGATCACTTTCCTCTGAGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198551.1-557s1c1
Sequence:CCGGCAGAGGAAAGTGATAGTGTATCTCGAGATACACTATCACTTTCCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198551.2-2901s21c1
Sequence:CCGGGGAGAGCCTGCCCTATAATATCTCGAGATATTATAGGGCAGGCTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198551.2-7354s21c1
Sequence:CCGGCTATATGTCCTCCCGTTTAATCTCGAGATTAAACGGGAGGACATATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198551.2-784s21c1
Sequence:CCGGGATAAGATTGATGCCTATAAACTCGAGTTTATAGGCATCAATCTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198551.2-3615s21c1
Sequence:CCGGTGTTGTGAAGGATAGAGTATACTCGAGTATACTCTATCCTTCACAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198551.2-4404s21c1
Sequence:CCGGGGTAGTTGAAGAGGATCTAAACTCGAGTTTAGATCCTCTTCAACTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198551.2-6741s21c1
Sequence:CCGGTTAGGACTGTGAGGGTTATAACTCGAGTTATAACCCTCACAGTCCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198551.2-5258s21c1
Sequence:CCGGTCGATGAAGGCAAGGTTAATACTCGAGTATTAACCTTGCCTTCATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)